Search result

BaseInfo

ncRNA ID	gma-miR171k-3p
Species	Glycine max
Class	miRNA
Genome position	chr13:26271135-26271232 [+]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	73 - UUGAGCCGCGCCAAUAUCACU - 93
Stem-loop(if miRNA)	G    C          A         C  A  -  -GA     A   A GA AAAG GAUGUUGGUG GGUUCAAUC GA GA CG   UUUAC UGU G || |||| |||||||||| ||||||||| || || ||   ||||| ||| CU UUUC CUAUAACCGC CCGAGUUAG CU CU GC   AAAUG ACG A   A    A          G         A  -  A  AUA     -   A
Stem-loop sequence	GAGAAAGCGAUGUUGGUGAGGUUCAAUCCGAAGACGGAUUUACAUGUAGAAGCAGUAAAAUACGAUCUCAGAUUGAGCCGCGCCAAUAUCACUUUAUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006576371.2	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   ||*|||||||||||||||||| targets:1630   AGGGAUAUUGGCGCGGCUCAA   1650 Target Full Sequence	1.0	PREDICTED: Glycine max scarecrow-like protein 6 (LOC100794596), mRNA	scarecrow-like protein 6(LOC100794596)	coding protein	psRNATarget
XM_003516392.3	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   ||*|||||||||||||||||| targets:1780   AGGGAUAUUGGCGCGGCUCAA   1800 Target Full Sequence	1.0	PREDICTED: Glycine max scarecrow-like protein 6 (LOC100801785), mRNA	scarecrow-like protein 6(LOC100801785)	coding protein	psRNATarget
XM_014773107.1	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   *|*|||||||||||||||||| targets:1513   CGGGAUAUUGGCGCGGCUCAA   1533 Target Full Sequence	1.0	PREDICTED: Glycine max scarecrow-like protein 6 (LOC100805945), mRNA	scarecrow-like protein 6(LOC100805945)	coding protein	psRNATarget
XM_006573169.2	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   *|*|||||||||||||||||| targets:1751   UGGGAUAUUGGCGCGGCUCAA   1771 Target Full Sequence	1.0	PREDICTED: Glycine max scarecrow-like protein 27 (LOC100792973), mRNA	scarecrow-like protein 27(LOC100792973)	coding protein	psRNATarget
XM_003538794.3	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   =||||||||||*||||||||| targets:709   GGUGAUAUUGGAGCGGCUCAA   729 Target Full Sequence	1.5	PREDICTED: Glycine max scarecrow-like protein 15 (LOC100784206), mRNA	scarecrow-like protein 15(LOC100784206)	coding protein	psRNATarget
XM_003517193.3	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   |*|||||||||*||||||||| targets:727   ACUGAUAUUGGAGCGGCUCAA   747 Target Full Sequence	1.5	PREDICTED: Glycine max scarecrow-like protein 15 (LOC100807470), mRNA	scarecrow-like protein 15(LOC100807470)	coding protein	psRNATarget
HI410514.1	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   *|*|||||||*|||||||||| targets:11   UGAGAUAUUGACGCGGCUCAA   31 Target Full Sequence	2.5	Sequence 8639 from Patent EP2074227	NA	coding protein	psRNATarget
LQ242644.1	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   *|*|||||||*|||||||||| targets:11   UGAGAUAUUGACGCGGCUCAA   31 Target Full Sequence	2.5	Sequence 8639 from Patent EP2985353	NA	coding protein	psRNATarget
JB170975.1	ncRNA:21   UCACUAUAACCGCGCCGAGUU   1   *|*|||||||*|||||||||| targets:11   UGAGAUAUUGACGCGGCUCAA   31 Target Full Sequence	2.5	Sequence 8639 from Patent EP2559767	NA	coding protein	psRNATarget

Reference

1	PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011).
2	PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011).