Search result

BaseInfo

ncRNA ID	gma-miR4413b
Species	Glycine max
Class	miRNA
Genome position	chr13:5170460-5170527 [+]
Reference genome	v1.0
Source	miRBase
Length	20
Mature sequence(if miRNA)	7 - UAAGAGAAUUGUAAGUCACU - 26
Stem-loop(if miRNA)	A A            A  ---U    A CAUCAAUA G GAAUUGUAAGUC CU    GAUU G |||||||| | |||||||||||| ||    |||| GUAGUUAU C CUUAACAUUCAG GG    UUAA G         G -            A  CAUU    A
Stem-loop sequence	CAUCAAUAAGAGAAUUGUAAGUCACUUGAUUAGGAAAUUUUACGGAGACUUACAAUUCCGUAUUGAUG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003530008.3	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   |||||||||||||||||||| targets:1274   AGUGACUUACAAUUCUCUUA   1293 Target Full Sequence	0.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100820602), mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100820602)	coding protein	psRNATarget
XM_014769021.1	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   *||||||||||||||||||| targets:1314   UGUGACUUACAAUUCUCUUA   1333 Target Full Sequence	0.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62910-like (LOC106796564), mRNA	pentatricopeptide repeat-containing protein At1g62910-like(LOC106796564)	coding protein	psRNATarget
XM_014768489.1	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||||||||||| targets:1161   AGUGACGUACAAUUCUCUUA   1180 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like (LOC100795807), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like(LOC100795807)	coding protein	psRNATarget
XM_006587401.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||||||||||| targets:1161   AGUGACAUACAAUUCUCUUA   1180 Target Full Sequence	1.0	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100781818), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100781818)	coding protein	psRNATarget
XM_014768490.1	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||||||||||| targets:1290   AGUGACGUACAAUUCUCUUA   1309 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like (LOC100795807), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At1g62670, mitochondrial-like(LOC100795807)	coding protein	psRNATarget
XM_014769273.1	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||||||||||| targets:1354   AGUGACGUACAAUUCUCUUA   1373 Target Full Sequence	1.0	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106796589), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106796589)	coding protein	psRNATarget
XM_014762238.1	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   =||*|||||||||||||||| targets:1243   GGUCACUUACAAUUCUCUUA   1262 Target Full Sequence	1.0	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC106794624), mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC106794624)	coding protein	psRNATarget
XM_006587773.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   *|||||*||||||||||||| targets:1299   CGUGACGUACAAUUCUCUUA   1318 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100778420), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100778420)	coding protein	psRNATarget
XM_006587774.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   *|||||*||||||||||||| targets:1299   CGUGACGUACAAUUCUCUUA   1318 Target Full Sequence	1.0	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like (LOC100778420), transcript variant X2, mRNA	pentatricopeptide repeat-containing protein At3g22470, mitochondrial-like(LOC100778420)	coding protein	psRNATarget
XM_006599565.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   *||||||||=|||||||||| targets:1490   UGUGACUUAUAAUUCUCUUA   1509 Target Full Sequence	1.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g62910-like (LOC100786237), transcript variant X1, mRNA	pentatricopeptide repeat-containing protein At1g62910-like(LOC100786237)	coding protein	psRNATarget
XM_014765336.1	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   =||*|||||||||||||||* targets:324   GGUCACUUACAAUUCUCUUU   343 Target Full Sequence	2.0	PREDICTED: Glycine max putative disease resistance protein At4g11170 (LOC100793798), transcript variant X2, mRNA	putative disease resistance protein At4g11170(LOC100793798)	coding protein	psRNATarget
XM_003548915.3	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||=|||||||| targets:1228   AGUGACGUACAGUUCUCUUA   1247 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC100807278), mRNA	pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like(LOC100807278)	coding protein	psRNATarget
XM_006599408.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||=|||||||| targets:1283   AGUGACAUACAGUUCUCUUA   1302 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100812093), transcript variant X1, mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100812093)	coding protein	psRNATarget
XM_006586949.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||=|||||||| targets:1183   AGUGACCUACAGUUCUCUUA   1202 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100794739), transcript variant X2, mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100794739)	coding protein	psRNATarget
XM_006586948.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||=|||||||| targets:1183   AGUGACCUACAGUUCUCUUA   1202 Target Full Sequence	2.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial (LOC100794739), transcript variant X1, mRNA	putative pentatricopeptide repeat-containing protein At1g12700, mitochondrial(LOC100794739)	coding protein	psRNATarget
XM_006599319.2	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   ||||||*||||=|||||||| targets:1268   AGUGACAUACAGUUCUCUUA   1287 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC102663208), mRNA	pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like(LOC102663208)	coding protein	psRNATarget
XM_003533275.3	ncRNA:20   UCACUGAAUGUUAAGAGAAU   1   *||*|||||||=|||||||| targets:1263   UGUAACUUACAGUUCUCUUA   1282 Target Full Sequence	2.5	PREDICTED: Glycine max pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like (LOC100778062), mRNA	pentatricopeptide repeat-containing protein At1g12300, mitochondrial-like(LOC100778062)	coding protein	psRNATarget

Reference

1

PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011).