Search result

BaseInfo

ncRNA ID	gma-miR171a
Species	Glycine max
Class	miRNA
Genome position	chr12:8443106-8443207 [+]
Reference genome	v1.0
Source	miRBase
Length	21
Mature sequence(if miRNA)	72 - UGAGCCGUGCCAAUAUCACGA - 92
Stem-loop(if miRNA)	--------    AACGG        UC         A        AU       A         GUUC     GAUAUUGG  CGGUUCAAU AGAAAGCA  GCUCAAA U         ||||     ||||||||  ||||||||| ||||||||  ||||||| G         CAAG     CUAUAACC  GCCGAGUUA UUUUUUGU  UGGGUUU U CUCGUCAC    ---CA        GU         C        CC       U
Stem-loop sequence	GUUCAACGGGAUAUUGGUCCGGUUCAAUAAGAAAGCAAUGCUCAAAAUGUUUUUGGGUCCUGUUUUUUCAUUGAGCCGUGCCAAUAUCACGAACCACUGCUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_014773107.1	ncRNA:21   AGCACUAUAACCGUGCCGAGU   1   *||*|||||||||=||||||| targets:1512   ACGGGAUAUUGGCGCGGCUCA   1532 Target Full Sequence	2.5	PREDICTED: Glycine max scarecrow-like protein 6 (LOC100805945), mRNA	scarecrow-like protein 6(LOC100805945)	coding protein	psRNATarget
XM_006573169.2	ncRNA:21   AGCACUAUAACCGUGCCGAGU   1   *=|*|||||||||=||||||| targets:1750   AUGGGAUAUUGGCGCGGCUCA   1770 Target Full Sequence	2.5	PREDICTED: Glycine max scarecrow-like protein 27 (LOC100792973), mRNA	scarecrow-like protein 27(LOC100792973)	coding protein	psRNATarget
XM_006576371.2	ncRNA:21   AGCACUAUAACCGUGCCGAGU   1   **|*|||||||||=||||||| targets:1629   AAGGGAUAUUGGCGCGGCUCA   1649 Target Full Sequence	2.5	PREDICTED: Glycine max scarecrow-like protein 6 (LOC100794596), mRNA	scarecrow-like protein 6(LOC100794596)	coding protein	psRNATarget
XM_003516392.3	ncRNA:21   AGCACUAUAACCGUGCCGAGU   1   **|*|||||||||=||||||| targets:1779   AAGGGAUAUUGGCGCGGCUCA   1799 Target Full Sequence	2.5	PREDICTED: Glycine max scarecrow-like protein 6 (LOC100801785), mRNA	scarecrow-like protein 6(LOC100801785)	coding protein	psRNATarget

Reference

1	PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots"; Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O; BMC Genomics. 9:160(2008).
2	PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011).
3	PMID:21751852 "Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011).