Search result

BaseInfo

ncRNA ID	ath-miR156c-3p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr4:15415418-15415521 [-]
Reference genome	TAIR10
Source	miRBase
Length	22
Mature sequence(if miRNA)	9 - GCUCACUGCUCUAUCUGUCAGA - 30
Stem-loop(if miRNA)	C  AUA   A        -    -         A   ---     CUU     G  GC   GAA CUGACAGA AGAG AGUGAGCAC CAA   AGGCA   UGCAU U  ||   ||| |||||||| |||| ||||||||| |||   |||||   ||||| U  CG   CUU GACUGUCU UCUC UCACUCGUG GUU   UUCGU   ACGUA C U  -GC   A        A    G         C   CUC     -UU     G
Stem-loop sequence	CGCAUAGAAACUGACAGAAGAGAGUGAGCACACAAAGGCACUUUGCAUGUUCGAUGCAUUUGCUUCUCUUGCGUGCUCACUGCUCUAUCUGUCAGAUUCCGGCU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_179985.2	ncRNA:22   AGACUGUCUAUCUCGUCACUCG   1   **|*|||||||*|||||||||| targets:818   AGUAACAGAUAAAGCAGUGAGC   839 Target Full Sequence	2.5	Arabidopsis thaliana alpha/beta-Hydrolases superfamily protein mRNA	alpha/beta-Hydrolases superfamily protein(AT2G39410)	coding protein	psRNATarget
NM_001336773.1	ncRNA:22   AGACUGUCUAUCUCGUCACUCG   1   **|*|||||||*|||||||||| targets:1036   AGUAACAGAUAAAGCAGUGAGC   1057 Target Full Sequence	2.5	Arabidopsis thaliana alpha/beta-Hydrolases superfamily protein mRNA	alpha/beta-Hydrolases superfamily protein(AT2G39410)	coding protein	psRNATarget

Reference

1	PMID:12101121 "MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002).
2	PMID:12202040 "Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002).
3	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
4	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
5	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
6	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).