ncRNA ID | gma-miR319j |
Species | Glycine max |
Class | miRNA |
Genome position | chr11:1374020-1374198 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 154 - UUGGACUGAAGGGAGCUCCCU - 174 |
Stem-loop(if miRNA) |
   U   A             C   CUC     U    A            A -  G   AC        A  CA        GA    A AGG AAG GAGCUCUCUUCAG CCA   AUAGG GAUA UAGGAUUUAAUU G CU CCG  UCAUUCAU CA  UGCUGAGU  AUUA U ||| ||| ||||||||||||| |||   ||||| |||| |||||||||||| | || |||  |||||||| ||  ||||||||  |||| G UCU UUC CUCGAGGGAAGUC GGU   UGUCU UUGU AUUCUAAGUUAA C GA GGC  AGUAAGUG GU  AUGACUCA  UAAU A    U   C             A   UCA     U    -            A A  G   AU        A  AA        --    A |
Stem-loop sequence | AGGUAAGAGAGCUCUCUUCAGCCCACUCAUAGGUGAUAAUAGGAUUUAAUUAGCUGCCGACUCAUUCAUACACAUGCUGAGUGAAUUAAUGAAUAAUACUCAGUAAAUGAGUGAAUGAUACGGGAGACAAAUUGAAUCUUAUGUUUUCUGUACUUGGACUGAAGGGAGCUCCCUUUUCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
HI410474.1 |
|
2.5 | Sequence 8599 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
JB170935.1 |
|
2.5 | Sequence 8599 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
LQ242604.1 |
|
2.5 | Sequence 8599 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
BT098668.1 |
|
2.5 | Soybean clone JCVI-FLGm-12F22 unknown mRNA | NA | coding protein | psRNATarget | |||||||||
XM_003526306.3 |
|
2.5 | PREDICTED: Glycine max transcription factor GAMYB-like (LOC100805804), transcript variant X2, mRNA | transcription factor GAMYB-like(LOC100805804) | coding protein | psRNATarget | |||||||||
XM_006582324.2 |
|
2.5 | PREDICTED: Glycine max transcription factor GAMYB-like (LOC100805804), transcript variant X1, mRNA | transcription factor GAMYB-like(LOC100805804) | coding protein | psRNATarget | |||||||||
XM_003523865.3 |
|
2.5 | PREDICTED: Glycine max transcription factor GAMYB-like (LOC100792349), transcript variant X2, mRNA | transcription factor GAMYB-like(LOC100792349) | coding protein | psRNATarget | |||||||||
XM_006578333.2 |
|
2.5 | PREDICTED: Glycine max transcription factor GAMYB-like (LOC100792349), transcript variant X1, mRNA | transcription factor GAMYB-like(LOC100792349) | coding protein | psRNATarget |
1 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
2 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |