Search result

BaseInfo

ncRNA ID gma-miR2118b-3p
Species Glycine max
Class miRNA
Genome position chr10:48574023-48574132 [-]
Reference genome v1.0
Source miRBase
Length 21
Mature sequence(if miRNA) 12 - UUGCCGAUUCCACCCAUUCCU - 32
Stem-loop(if miRNA) U        G       A    A   -           --U       U UC  UGA
 GAGGAAGU AUGGGAG UGGG GGG UCGGUAAAGGA   AACAGCG C  UA   U
 |||||||| ||||||| |||| ||| |||||||||||   ||||||| |  ||
 UUCUUUUA UAUCCUU ACCC CCU AGCCGUUUUCU   UUGUUGU G  GU   U
-        G       -    A   U           UAU       - UU  UAA
Stem-loop sequence UGAGGAAGUGAUGGGAGAUGGGAGGGUCGGUAAAGGAUAACAGCGUCUCUAUGAUUAAUUGUUGUGUUGUUUAUUCUUUUGCCGAUUCCACCCAUUCCUAUGAUUUUCUU

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_014778910.1
ncRNA:21   UCCUUACCCACCUUAGCCGUU   1
  |||||*|*||||||||||||*
targets:1567   AGGAAGGCGUGGAAUCGGCAC   1587

3.0 PREDICTED: Glycine max uncharacterized LOC100780705 (LOC100780705), transcript variant X3, mRNA uncharacterized LOC100780705(LOC100780705) coding protein psRNATarget
XM_014778909.1
ncRNA:21   UCCUUACCCACCUUAGCCGUU   1
  |||||*|*||||||||||||*
targets:1725   AGGAAGGCGUGGAAUCGGCAC   1745

3.0 PREDICTED: Glycine max uncharacterized LOC100780705 (LOC100780705), transcript variant X2, mRNA uncharacterized LOC100780705(LOC100780705) coding protein psRNATarget
XM_014778908.1
ncRNA:21   UCCUUACCCACCUUAGCCGUU   1
  |||||*|*||||||||||||*
targets:1893   AGGAAGGCGUGGAAUCGGCAC   1913

3.0 PREDICTED: Glycine max uncharacterized LOC100780705 (LOC100780705), transcript variant X1, mRNA uncharacterized LOC100780705(LOC100780705) coding protein psRNATarget

Reference

1 PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean";
Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL;
J Exp Bot. 62:2495-2506(2011).
2 PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses";
Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R;
BMC Genomics. 12:307(2011).
3 PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs";
Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC;
Genes Dev. 25:2540-2553(2011).
4 PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons";
Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ;
PLoS One. 9:e86153(2014).