ncRNA ID | gma-miR167h |
Species | Glycine max |
Class | miRNA |
Genome position | chr10:46574263-46574351 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 61 - AUCAUGCUGGCAGCUUCAACUGGU - 84 |
Stem-loop(if miRNA) |
-A        G    A      -        GAU      A  G   ACUACUAG UGAA CUGCCA CAUGAUCU   CUUUCC CA C   |||||||| |||| |||||| ||||||||   |||||| || A   UGAUGGUC ACUU GACGGU GUACUAGA   GAAGGG GU A GG        A    C      C        AUU      A  G |
Stem-loop sequence | AACUACUAGGUGAAACUGCCACAUGAUCUGAUCUUUCCACAGCAAGUGAGGGAAGUUAAGAUCAUGCUGGCAGCUUCAACUGGUAGUGG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
HI410605.1 |
|
0.0 | Sequence 8730 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
JB171066.1 |
|
0.0 | Sequence 8730 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
LQ242735.1 |
|
0.0 | Sequence 8730 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
JB171012.1 |
|
0.0 | Sequence 8676 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
LQ242681.1 |
|
0.0 | Sequence 8676 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
HI410551.1 |
|
0.0 | Sequence 8676 from Patent EP2074227 | NA | coding protein | psRNATarget |
1 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |
2 | PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"; Radwan O, Liu Y, Clough SJ; Mol Plant Microbe Interact. 24:958-972(2011). |