ncRNA ID | gma-miR167g |
Species | Glycine max |
Class | miRNA |
Genome position | chr10:39044877-39044954 [+] |
Reference genome | v1.0 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 8 - UGAAGCUGCCAGCAUGAUCUGA - 29 |
Stem-loop(if miRNA) |
      U      U    G         AG      UU CAGCAG UGAAGC GCCA CAUGAUCUG  UUUACC  C |||||| |||||| |||| |||||||||  ||||||  U GUUGUC ACUUCG CGGU GUACUAGAC  GAAUGG  A       C      U    -         AA      UU |
Stem-loop sequence | CAGCAGUUGAAGCUGCCAGCAUGAUCUGAGUUUACCUUCUAUUGGUAAGAACAGAUCAUGUGGCUGCUUCACCUGUUG |
1 | PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"; Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G; BMC Bioinformatics. 11 Suppl 1:S14(2010). |
2 | PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"; Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL; J Exp Bot. 62:2495-2506(2011). |