ncRNA ID | gma-miR408c-3p |
Species | Glycine max |
Class | miRNA |
Genome position | chr10:36557005-36557130 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 7 - AUGCACUGCCUCUUCCCUGGC - 27 |
Stem-loop(if miRNA) |
        A      C      A     GA        U    ACAAUA  G CAAGAAAGUGAGA GACAAAGC GGGGAA AGGCAG GCAUG  UGGAGCUA CAAC      UU U             A |||||||| |||||| |||||| |||||  |||||||| ||||      || | CUGUUUCG UCCCUU UCCGUC CGUAC  GUCUUGGU GUUG      UC U             A         G      C      A     UC        -    ------  - AAAGAGGAGAGUG |
Stem-loop sequence | GACAAAGCAGGGGAACAGGCAGAGCAUGGAUGGAGCUAUCAACACAAUAUUGUCAAGAAAGUGAGAAAGUGAGAGGAGAAAUCUGUUGUGGUUCUGCUCAUGCACUGCCUCUUCCCUGGCUUUGUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BT089263.1 |
|
0.0 | Soybean clone JCVI-FLGm-1D15 unknown mRNA | NA | coding protein | psRNATarget | |||||||||
NM_001250602.1 |
|
0.0 | Glycine max uncharacterized LOC100305588 (LOC100305588), mRNA | uncharacterized LOC100305588(LOC100305588) | coding protein | psRNATarget | |||||||||
XM_006574075.2 |
|
2.5 | PREDICTED: Glycine max ankyrin-1-like (LOC102663619), mRNA | ankyrin-1-like(LOC102663619) | coding protein | psRNATarget |
1 | PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"; Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R; BMC Genomics. 12:307(2011). |
2 | PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"; Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC; Genes Dev. 25:2540-2553(2011). |