ncRNA ID | gma-miR9755 |
Species | Glycine max |
Class | miRNA |
Genome position | chr1:24948438-24948530 [-] |
Reference genome | v1.0 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 13 - UGAUCCAGGAACUUUUCAUCU - 33 |
Stem-loop(if miRNA) |
   A        -        A   A            CAA   AA GGU AAAAUUGA GGUGAAAA UUC UGGAUCAGUUUU   UGC  C ||| |||||||| |||||||| ||| ||||||||||||   ||| CCA UUUUAACU CUACUUUU AAG ACCUAGUCAAAA   ACG  U    A        U        C   G            UAA   CU |
Stem-loop sequence | GGUAAAAAUUGAGGUGAAAAAUUCAUGGAUCAGUUUUCAAUGCAACUUCGCAAAUAAAACUGAUCCAGGAACUUUUCAUCUUCAAUUUUAACC |
1 | PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"; Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ; PLoS One. 9:e86153(2014). |