ncRNA ID | ath-miR397b |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr4:7878652-7878760 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 79 - UCAUUGAGUGCAUCGUUGAUG - 99 |
Stem-loop(if miRNA) |
-U   U      C          U          AUUU     A   ----U    CA   GAA GAACAU AUUGAGUGCA CGUUGAUGUA    UACUU UUU     AUUC  U   ||| |||||| |||||||||| ||||||||||    ||||| |||     ||||  U   CUU UUUGUA UAACUUACGU GCGACUAUAU    AUGAA AAA     UAAG  G AU   -      U          U          ----     G   UUAAU    UU |
Stem-loop sequence | UGAAUGAACAUCAUUGAGUGCAUCGUUGAUGUAAUUUUACUUAUUUUAUUCCAUUGUUGAAUUAAUUAAAGAAGUAUAUAUCAGCGUUGCAUUCAAUUAUGUUUUUCUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_128470.5 |
|
2.5 | Arabidopsis thaliana laccase 2 (LAC2), mRNA | laccase 2(LAC2) | coding protein | psRNATarget | |||||||||
DQ446263.1 |
|
2.5 | Arabidopsis thaliana clone pENTR221-At1g19500 hypothetical protein (At1g19500) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
DQ652845.1 |
|
2.5 | Arabidopsis thaliana clone 0000016367_0000011454 unknown mRNA | NA | coding protein | psRNATarget | |||||||||
AY800587.1 |
|
2.5 | Arabidopsis thaliana clone H0000001131 hypothetical protein (AT1G19500) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_101807.4 |
|
2.5 | Arabidopsis thaliana hypothetical protein mRNA | hypothetical protein(AT1G19500) | coding protein | psRNATarget | |||||||||
NM_001341215.1 |
|
2.5 | Arabidopsis thaliana G2484-1 protein (G2484-1), mRNA | G2484-1 protein(G2484-1) | coding protein | psRNATarget | |||||||||
NM_117837.7 |
|
2.5 | Arabidopsis thaliana G2484-1 protein (G2484-1), mRNA | G2484-1 protein(G2484-1) | coding protein | psRNATarget | |||||||||
NM_001341214.1 |
|
2.5 | Arabidopsis thaliana G2484-1 protein (G2484-1), mRNA | G2484-1 protein(G2484-1) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |