ncRNA ID | ath-miR397a |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr4:2625950-2626056 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - UCAUUGAGUGCAGCGUUGAUG - 31 |
Stem-loop(if miRNA) |
-U   U      C                A     U   G     UUU      G   GAA GAACAU AUUGAGUGCAGCGUUG UGUAA UUC UUUUG   UUCAUU U   ||| |||||| |||||||||||||||| ||||| ||| |||||   ||||||   CUU UUUGUA UAACUCGCGUUGCGAC AUAUU AAG AAAAU   AGGUAA U AU   -      U                C     U   -     --U      G |
Stem-loop sequence | UGAAUGAACAUCAUUGAGUGCAGCGUUGAUGUAAUUUCGUUUUGUUUUUCAUUGUUGAAUGGAUUAAAAGAAUUUAUACCAGCGUUGCGCUCAAUUAUGUUUUUCUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_128470.5 |
|
1.0 | Arabidopsis thaliana laccase 2 (LAC2), mRNA | laccase 2(LAC2) | coding protein | psRNATarget | |||||||||
AY063730.1 |
|
1.5 | Arabidopsis thaliana At2g38080/T8P21. mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY114636.1 |
|
1.5 | Arabidopsis thaliana putative diphenol oxidase (At2g38080) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY052669.1 |
|
1.5 | Arabidopsis thaliana At2g38080/T8P21. mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AY065187.1 |
|
1.5 | Arabidopsis thaliana putative diphenol oxidase (At2g38080; F16M14.1) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX819300.1 |
|
1.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB66ZE03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
NM_129364.4 |
|
1.5 | Arabidopsis thaliana Laccase/Diphenol oxidase family protein (IRX12), mRNA | Laccase/Diphenol oxidase family protein(IRX12) | coding protein | psRNATarget | |||||||||
NM_001345383.1 |
|
2.5 | Arabidopsis thaliana laccase 17 (LAC17), partial mRNA | laccase 17(LAC17) | coding protein | psRNATarget | |||||||||
NM_001345382.1 |
|
2.5 | Arabidopsis thaliana laccase 17 (LAC17), partial mRNA | laccase 17(LAC17) | coding protein | psRNATarget | |||||||||
BT015890.1 |
|
2.5 | Arabidopsis thaliana At5g60020 gene, complete cds | NA | coding protein | psRNATarget | |||||||||
BT015359.1 |
|
2.5 | Arabidopsis thaliana At5g60020 gene, complete cds | NA | coding protein | psRNATarget | |||||||||
BX832306.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH64ZD11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
NM_125395.3 |
|
2.5 | Arabidopsis thaliana laccase 17 (LAC17), mRNA | laccase 17(LAC17) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |