ncRNA ID | ath-miR447c-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr4:1523306-1523503 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 57 - UUGGGGACGACAUCUUUUGUUG - 78 |
Stem-loop(if miRNA) |
       A     C      U UU    A G   U  G      ACA         A       C    -    G U        CU  G  CUU     U CAUUCUU AUAUA AAUACU C  UUUC U CAU AA CCCCUU   AUGUCGAGU AACAAAG AUGU GUCC C AAUAUUGU  UC AG   GGUAU U ||||||| ||||| |||||| |  |||| | ||| || ||||||   ||||||||| ||||||| |||| |||| | ||||||||  || ||   ||||| GUAAGAA UAUAU UUAUGA G  AAAG A GUG UU GGGGAA   UAUAGCUCA UUGUUUU UACA CAGG G UUAUGGCA  AG UC   UUAUG U        C     A      U UU    A G   U  G      GAA         G       C    G    G U        -U  -  ---     U |
Stem-loop sequence | CAUUCUUAAUAUACAAUACUUCUUUUUCAUGCAUUAAGCCCCUUACAAUGUCGAGUAAACAAAGCAUGUGUCCGCUAAUAUUGUCUUCGAGCUUGGUAUUUUUGUAUUCUGAUACGGUAUUUGGGGACGACAUCUUUUGUUGACUCGAUAUAAGAAGGGGGUUUGUGGAAGAAAUUGUAGUAUUAUAUAUCAAGAAUG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
FJ591134.1 |
|
2.5 | Arabidopsis thaliana type-1 phosphatidic acid phosphohydrolase 2 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_001203528.2 |
|
2.5 | Arabidopsis thaliana phosphatidic acid phosphohydrolase 2 (PAH2), mRNA | phosphatidic acid phosphohydrolase 2(PAH2) | coding protein | psRNATarget | |||||||||
NM_123652.3 |
|
2.5 | Arabidopsis thaliana phosphatidic acid phosphohydrolase 2 (PAH2), mRNA | phosphatidic acid phosphohydrolase 2(PAH2) | coding protein | psRNATarget | |||||||||
NM_001344465.1 |
|
2.5 | Arabidopsis thaliana phosphatidic acid phosphohydrolase 2 (PAH2), mRNA | phosphatidic acid phosphohydrolase 2(PAH2) | coding protein | psRNATarget |
1 | PMID:15851028
"microRNA-directed phasing during trans-acting siRNA biogenesis in plants"; Allen E, Xie Z, Gustafson AM, Carrington JC; Cell. 121:207-221(2005). |
2 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
3 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
4 | PMID:21357774
"MicroRNA activity in the Arabidopsis male germline"; Borges F, Pereira PA, Slotkin RK, Martienssen RA, Becker JD; J Exp Bot. 62:1611-1620(2011). |