Search result

BaseInfo

ncRNA ID	ath-miR8182
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr3:22678152-22678279 [+]
Reference genome	TAIR10
Source	miRBase
Length	22
Mature sequence(if miRNA)	15 - UUGUGUUGCGUUUCUGUUGAUU - 36
Stem-loop(if miRNA)	A       G   C    C       U U -CU        ---UCCUC CG  UC UUAUCUUCAU CUUUUGU UUG GUUU UGUUGAU C C   UUUAUGUA        U  GC  U |||||||||| ||||||| ||| |||| ||||||| | |   ||||||||        |  || AGUAGAAGUA GAAGACA AAC CAAA ACAACUA G G   AAAUACAU        A  UG  C           C       A   A    U       C U CUC        UAUUUUCU AU  CU
Stem-loop sequence	UUAUCUUCAUACUUUUGUGUUGCGUUUCUGUUGAUUCUCCUUUUAUGUAUCCUCUCGGCUCUCUCGUUAAUCUUUUAUUACAUAAACUCGUGCAUCAACAUAAACACAAAACAGAAGCAUGAAGAUGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX827702.1	ncRNA:22   UUAGUUGUCUUUGCGUUGUGUU   1   ||*=|=||*||||||||||||| targets:833   AACUAGCAUAAACGCAACACAA   854 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH11ZH10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget

Reference

1	PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013).