| ncRNA ID | ath-miR827 |
| Species | Arabidopsis thaliana |
| Class | miRNA |
| Genome position | chr3:22122760-22122936 [-] |
| Reference genome | TAIR10 |
| Source | miRBase |
| Length | 21 |
| Mature sequence(if miRNA) | 52 - UUAGAUGACCAUCAACAAACU - 72 |
| Stem-loop(if miRNA) |
- AUGAAACGUUAUAGGUUUUUUUCUUUCUCUCUUGCAACCCUUGAAUGUGUUUGUUGAUUGAUAUCUACACAUGUUGAUCAUCC UUCC U |||| UACG U C AUUUUUGUACUAGCUCUAAGGUUCUUCGCUACGUUUUGGUGCUUUCUCAAACAACUACCAGUAGAUUUGGUUAGCUAGUUGUG |
| Stem-loop sequence | UUCCAUGAAACGUUAUAGGUUUUUUUCUUUCUCUCUUGCAACCCUUGAAUGUGUUUGUUGAUUGAUAUCUACACAUGUUGAUCAUCCUUGUGUUGAUCGAUUGGUUUAGAUGACCAUCAACAAACUCUUUCGUGGUUUUGCAUCGCUUCUUGGAAUCUCGAUCAUGUUUUUAGCAUC |
| Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NM_100167.3 |
|
0.0 | Arabidopsis thaliana SPX (SYG1/Pho81/XPR1) domain-containing protein (NLA), mRNA | SPX (SYG1/Pho81/XPR1) domain-containing protein(NLA) | coding protein | psRNATarget | |||||||||
| NM_001123746.1 |
|
0.0 | Arabidopsis thaliana SPX (SYG1/Pho81/XPR1) domain-containing protein (NLA), mRNA | SPX (SYG1/Pho81/XPR1) domain-containing protein(NLA) | coding protein | psRNATarget | |||||||||
| BX816480.1 |
|
0.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH50ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
| AK229396.1 |
|
0.0 | Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL16-64-D14 | NA | coding protein | psRNATarget | |||||||||
| AY088823.1 |
|
0.0 | Arabidopsis thaliana clone 96370 mRNA, complete sequence | NA | coding protein | psRNATarget | |||||||||
| BX813622.1 |
|
0.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB28ZF12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
| BX814861.1 |
|
0.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS12ZC01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
| BX815668.1 |
|
0.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS81ZH10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
| NM_001331361.1 |
|
0.0 | Arabidopsis thaliana SPX (SYG1/Pho81/XPR1) domain-containing protein (NLA), partial mRNA | SPX (SYG1/Pho81/XPR1) domain-containing protein(NLA) | coding protein | psRNATarget |
| 1 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
| 2 | PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"; Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC; PLoS One. 2:e219(2007). |
| 3 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |