Search result

BaseInfo

ncRNA ID	ath-miR393b-5p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr3:20691647-20691806 [+]
Reference genome	TAIR10
Source	miRBase
Length	22
Mature sequence(if miRNA)	11 - UCCAAAGGGAUCGCAUUGAUCC - 32
Stem-loop(if miRNA)	A                   U     ---U  U     -------------U  UUUAUUCCCCAAUAAUUGUUUUUUUUU AGAGAA GGAUCCAAAGGGAUCGCAU GAUCC    AA UAAGC              GA                           U |||||| ||||||||||||||||||| |||||    || |||||              ||                           C UUUCUU CUUAGGUUUCUCUAGCGUA CUAGG    UU AUUCG              AA                           C       A                   -     CCUU  C     UUUUACAAACCUUA  CAAAAAGAAGGUAGAAAGCUAACUCUU
Stem-loop sequence	AGAGAAAGGAUCCAAAGGGAUCGCAUUGAUCCUAAUUAAGCUGAUUUAUUCCCCAAUAAUUGUUUUUUUUUUCCUUCUCAAUCGAAAGAUGGAAGAAAAACAAAUUCCAAACAUUUUGCUUACUUUUCCGGAUCAUGCGAUCUCUUUGGAUUCAUUCUUU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT010396.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:1501   GAAACAAUGCGAUCCCUUUGGA   1522 Target Full Sequence	1.0	Arabidopsis thaliana At3g26830 mRNA, complete cds	NA	coding protein	psRNATarget
BT002118.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:1507   GAAACAAUGCGAUCCCUUUGGA   1528 Target Full Sequence	1.0	Arabidopsis thaliana transport inhibitor response 1, putative (At1g12820) mRNA, complete cds	NA	coding protein	psRNATarget
AK227280.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:1862   GAAACAAUGCGAUCCCUUUGGA   1883 Target Full Sequence	1.0	Arabidopsis thaliana mRNA for putative transport inhibitor response 1, complete cds, clone: RAFL11-11-G19	NA	coding protein	psRNATarget
BX816533.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:1840   GAAACAAUGCGAUCCCUUUGGA   1861 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH54ZA12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY099541.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:1883   GAAACAAUGCGAUCCCUUUGGA   1904 Target Full Sequence	1.0	Arabidopsis thaliana transport inhibitor response 1, putative (At1g12820) mRNA, complete cds	NA	coding protein	psRNATarget
NM_101152.5	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:1888   GAAACAAUGCGAUCCCUUUGGA   1909 Target Full Sequence	1.0	Arabidopsis thaliana auxin signaling F-box 3 (AFB3), mRNA	auxin signaling F-box 3(AFB3)	coding protein	psRNATarget
BX823269.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:2007   GAAACAAUGCGAUCCCUUUGGA   2028 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS18ZF11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY062568.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:2002   GAAACAAUGCGAUCCCUUUGGA   2023 Target Full Sequence	1.0	Arabidopsis thaliana transport inhibitor response-like protein (At3g26830; MDJ14.12) mRNA, complete cds	NA	coding protein	psRNATarget
NM_113593.3	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   |*|*|||||||||||||||||| targets:2191   GAAACAAUGCGAUCCCUUUGGA   2212 Target Full Sequence	1.0	Arabidopsis thaliana auxin signaling F-box 2 (AFB2), mRNA	auxin signaling F-box 2(AFB2)	coding protein	psRNATarget
AK220790.1	ncRNA:22   CCUA-GUUACGCUAGGGAAACCU   1   |||*-|||||||||||||||||| targets:443   GGAGACAAUGCGAUCCCUUUGGA   465 Target Full Sequence	3.0	Arabidopsis thaliana mRNA for transport inhibitor response 1, complete cds, clone: RAFL22-27-N07	NA	coding protein	psRNATarget
BT001946.1	ncRNA:22   CCUA-GUUACGCUAGGGAAACCU   1   |||*-|||||||||||||||||| targets:1515   GGAGACAAUGCGAUCCCUUUGGA   1537 Target Full Sequence	3.0	Arabidopsis thaliana clone C105370 putative transport inhibitor response TIR1, AtFBL1 protein (At3g62980) mRNA, complete cds	NA	coding protein	psRNATarget
AF005048.1	ncRNA:22   CCUA-GUUACGCUAGGGAAACCU   1   |||*-|||||||||||||||||| targets:1658   GGAGACAAUGCGAUCCCUUUGGA   1680 Target Full Sequence	3.0	Arabidopsis thaliana transport inhibitor response 1 (TIR1) mRNA, complete cds	NA	coding protein	psRNATarget
AF327430.1	ncRNA:22   CCUA-GUUACGCUAGGGAAACCU   1   |||*-|||||||||||||||||| targets:1707   GGAGACAAUGCGAUCCCUUUGGA   1729 Target Full Sequence	3.0	Arabidopsis thaliana At3g62980 mRNA sequence	NA	coding protein	psRNATarget
NM_116163.4	ncRNA:22   CCUA-GUUACGCUAGGGAAACCU   1   |||*-|||||||||||||||||| targets:1964   GGAGACAAUGCGAUCCCUUUGGA   1986 Target Full Sequence	3.0	Arabidopsis thaliana F-box/RNI-like superfamily protein (TIR1), mRNA	F-box/RNI-like superfamily protein(TIR1)	coding protein	psRNATarget
AY096536.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   ||=|||=*|||||||||||||* targets:48   GGGUCAGAGCGAUCCCUUUGGC   69 Target Full Sequence	3.0	Arabidopsis thaliana putative DNA-binding protein (At3g23690) mRNA, complete cds	NA	coding protein	psRNATarget
BX824627.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   ||=|||=*|||||||||||||* targets:362   GGGUCAGAGCGAUCCCUUUGGC   383 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH60ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY065441.1	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   ||=|||=*|||||||||||||* targets:408   GGGUCAGAGCGAUCCCUUUGGC   429 Target Full Sequence	3.0	Arabidopsis thaliana putative DNA-binding protein (At3g23690) mRNA, complete cds	NA	coding protein	psRNATarget
NM_113273.4	ncRNA:22   CCUAGUUACGCUAGGGAAACCU   1   ||=|||=*|||||||||||||* targets:751   GGGUCAGAGCGAUCCCUUUGGC   772 Target Full Sequence	3.0	Arabidopsis thaliana basic helix-loop-helix (bHLH) DNA-binding superfamily protein mRNA	basic helix-loop-helix (bHLH) DNA-binding superfamily protein(AT3G23690)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004).
3	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
4	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
5	PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013).