Search result

BaseInfo

ncRNA ID	novel_gma_miR8917
Species	Glycine max
Class	miRNA
Genome position	Chr5:36533936-36534063 [+]
Reference genome	Glycine_max_v2.0
Source	SRR1451621
Length	20
Mature sequence(if miRNA)	109 - CAAAAUUAAUUAUGGACCAU - 128
Stem-loop(if miRNA)	--    -AA             G  AU     UUAUG        -    AAA  A        UAC   GGUU   GAUUGAUUUUGAA UG  GUGAU     UUUGAAUA UUUU   GU AAAUUCAA   A   ||||   ||||||||||||| ||  |||||     |||||||| ||||   || ||||||||   A   CCAG   UUAAUUAAAACUU AC  CAUUG     AAAUUUAU AAAA   CA UUUAAGUU   A UA    GUA             A  CU     -----        U    ACG  A        UUA
Stem-loop sequence	GGUUAAGAUUGAUUUUGAAGUGAUGUGAUUUAUGUUUGAAUAUUUUAAAGUAAAAUUCAAUACAAAAUUUUGAAUUUAACGCAAAAAUUAUUUAAAGUUACUCCAAUUCAAAAUUAAUUAUGGACCAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006594030.2	ncRNA:20   UACCAGGUAUUAAUUAAAAC   1   ||||||||*||||||||||* targets:1346   AUGGUCCAAAAUUAAUUUUA   1365 Target Full Sequence	2.5	PREDICTED: Glycine max thylakoid membrane protein TERC, chloroplastic-like (LOC100820402), transcript variant X4, mRNA	thylakoid membrane protein TERC, chloroplastic-like(LOC100820402)	coding protein	psRNATarget
XM_003542439.3	ncRNA:20   UACCAGGUAUUAAUUAAAAC   1   ||||||||*||||||||||* targets:1464   AUGGUCCAAAAUUAAUUUUA   1483 Target Full Sequence	2.5	PREDICTED: Glycine max thylakoid membrane protein TERC, chloroplastic-like (LOC100820402), transcript variant X1, mRNA	thylakoid membrane protein TERC, chloroplastic-like(LOC100820402)	coding protein	psRNATarget
XM_006596449.2	ncRNA:20   UACCAGGUAUUAAUUAAAAC   1   *|||||||||||*||||||* targets:4339   UUGGUCCAUAAUAAAUUUUU   4358 Target Full Sequence	2.5	PREDICTED: Glycine max regulator of telomere elongation helicase 1 homolog (LOC100779610), transcript variant X4, mRNA	regulator of telomere elongation helicase 1 homolog(LOC100779610)	coding protein	psRNATarget
XM_014767199.1	ncRNA:20   UACCAGGUAUUAAUUAAAAC   1   *|||||||||||*||||||* targets:4419   UUGGUCCAUAAUAAAUUUUU   4438 Target Full Sequence	2.5	PREDICTED: Glycine max regulator of telomere elongation helicase 1 homolog (LOC100779610), transcript variant X6, mRNA	regulator of telomere elongation helicase 1 homolog(LOC100779610)	coding protein	psRNATarget
XM_014767198.1	ncRNA:20   UACCAGGUAUUAAUUAAAAC   1   *|||||||||||*||||||* targets:4433   UUGGUCCAUAAUAAAUUUUU   4452 Target Full Sequence	2.5	PREDICTED: Glycine max regulator of telomere elongation helicase 1 homolog (LOC100779610), transcript variant X5, mRNA	regulator of telomere elongation helicase 1 homolog(LOC100779610)	coding protein	psRNATarget
XM_014767197.1	ncRNA:20   UACCAGGUAUUAAUUAAAAC   1   *|||||||||||*||||||* targets:4451   UUGGUCCAUAAUAAAUUUUU   4470 Target Full Sequence	2.5	PREDICTED: Glycine max regulator of telomere elongation helicase 1 homolog (LOC100779610), transcript variant X1, mRNA	regulator of telomere elongation helicase 1 homolog(LOC100779610)	coding protein	psRNATarget