ncRNA ID | novel_gma_miR8423 |
Species | Glycine max |
Class | miRNA |
Genome position | Chr4:37082538-37082599 [+] |
Reference genome | Glycine_max_v2.0 |
Source | SRR1451618 |
Length | 21 |
Mature sequence(if miRNA) | 1 - UGGAUUGACAAUCUGUAUGGU - 21 |
Stem-loop(if miRNA) |
--                   -GUUCUU  A   UGGAUUGACAAUCUGUAUG       AC U   |||||||||||||||||||       || A   ACCUAACUGUUAGACAUAU       UG U AU                   GUCUAAU  U |
Stem-loop sequence | UGGAUUGACAAUCUGUAUGGUUCUUACAUAUUGUUAAUCUGUAUACAGAUUGUCAAUCCAUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_006594260.2 |
|
3.0 | PREDICTED: Glycine max mediator of RNA polymerase II transcription subunit 16-like (LOC100793949), transcript variant X1, mRNA | mediator of RNA polymerase II transcription subunit 16-like(LOC100793949) | coding protein | psRNATarget |