Search result

BaseInfo

ncRNA ID	ath-miR5997
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr3:10706765-10706908 [+]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	104 - UGAAACCAAGUAGCUAAAUAG - 124
Stem-loop(if miRNA)	ACCCAUUCUCUAGAUCUCAAC     -G            C                          C  UUUUUUACAUAU    A                      AGGUU  UUCCUCCUUCUU CUAUUUAGUUACUUGGUUUCAAUUGU UC            GCUU C                      |||||  |||||||||||| |||||||||||||||||||||||||| ||            ||||                      UCCAA  GAGGAGGAAGAA GAUAAAUCGAUGAACCAAAGUUAACA AG            CGGA C ---------------------     AG            A                          A  ----------UU    U
Stem-loop sequence	ACCCAUUCUCUAGAUCUCAACAGGUUGUUCCUCCUUCUUCCUAUUUAGUUACUUGGUUUCAAUUGUCUCUUUUUUACAUAUGCUUACCUAGGCUUGAAACAAUUGAAACCAAGUAGCUAAAUAGAAAGAAGGAGGAGGAAACCU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
KM397818.1	ncRNA:21   GAUAAAUCGAUGAACCAAAGU   1   |*||||||||||||*|||||* targets:169   CGAUUUAGCUACUUUGUUUCU   189 Target Full Sequence	2.5	Arabidopsis thaliana AT4G36440-like protein mRNA, partial cds	NA	coding protein	psRNATarget
NM_001336757.1	ncRNA:21   GAUAAAUCGAUGAACCAAAGU   1   |*|||||*|||||||||*||| targets:1735   CAAUUUACCUACUUGGUCUCA   1755 Target Full Sequence	2.5	Arabidopsis thaliana Protein kinase superfamily protein mRNA	Protein kinase superfamily protein(AT2G39110)	coding protein	psRNATarget
NM_179980.4	ncRNA:21   GAUAAAUCGAUGAACCAAAGU   1   |*|||||*|||||||||*||| targets:1589   CAAUUUACCUACUUGGUCUCA   1609 Target Full Sequence	2.5	Arabidopsis thaliana Protein kinase superfamily protein mRNA	Protein kinase superfamily protein(AT2G39110)	coding protein	psRNATarget
AK227976.1	ncRNA:21   GAUAAAUCGAUGAACCAAAGU   1   |*|||||*|||||||||*||| targets:1372   CAAUUUACCUACUUGGUCUCA   1392 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for putative protein kinase, complete cds, clone: RAFL14-51-L04	NA	coding protein	psRNATarget
BX820361.1	ncRNA:21   GAUAAAUCGAUGAACCAAAGU   1   |*|||||*|||||||||*||| targets:1320   CAAUUUACCUACUUGGUCUCA   1340 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH26ZA04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT004631.1	ncRNA:21   GAUAAAUCGAUGAACCAAAGU   1   |*|||||*|||||||||*||| targets:1266   CAAUUUACCUACUUGGUCUCA   1286 Target Full Sequence	2.5	Arabidopsis thaliana At2g39110 gene, complete cds	NA	coding protein	psRNATarget
NM_001338237.1	ncRNA:21   GAUAAA-UCGAUGAACCAAAGU   1   **||||-||||||||||||||* targets:1113   AGAUUUCAGCUACUUGGUUUCU   1134 Target Full Sequence	3.0	Arabidopsis thaliana DegP protease 11 (DEG11), partial mRNA	DegP protease 11(DEG11)	coding protein	psRNATarget

Reference

1	PMID:22221297 "Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology"; Zhang B, Xie D, Jin Z; J Integr Plant Biol. 54:73-86(2012).