ncRNA ID | ath-miR169i |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr3:9871960-9872165 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 147 - UAGCCAAGGAUGACUUGCCUG - 167 |
Stem-loop(if miRNA) |
     -A      AA       -U       U     UU  -          U    U      -C     -----GU        -UU     UCUUGUUUGAAGUC GAAGG  GAUGUC  AGAUGAA  AGAAGAA CAUAU  GG UAGCCAAGGA GACU GCCUGA  UCUUU       GUAAAAUG   UAGUG              A |||||  ||||||  |||||||  ||||||| |||||  || |||||||||| |||| ||||||  |||||       ||||||||   |||||              C CUUCC  UUACAG  UCUACUU  UCUUCUU GUAUA  CC AUCGGUUCCU CUGA CGGACU  AGAAA       CGUUUUAC   UAACG              U      AC      AC       UC       -     UU  U          -    -      AU     AAAUAUU        CAG     AACUAUGUUGAAUA |
Stem-loop sequence | GAAGGAGAUGUCAAAGAUGAAUAGAAGAAUCAUAUUUGGUAGCCAAGGAUGACUUGCCUGACUCUUUGUGUAAAAUGUUUAGUGUCUUGUUUGAAGUCACUAUAAGUUGUAUCAAGCAAUGACCAUUUUGCUUAUAAAAAAGAUAUCAGGCAGUCUCCUUGGCUAUCCUUAUAUGUUCUUCUCUUUCAUCUCAGACAUUCACCUUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_001338098.1 |
|
1.0 | Arabidopsis thaliana nuclear factor Y, subunit A6 (NF-YA6), mRNA | nuclear factor Y, subunit A6(NF-YA6) | coding protein | psRNATarget | |||||||||
NM_112256.3 |
|
1.0 | Arabidopsis thaliana nuclear factor Y, subunit A6 (NF-YA6), mRNA | nuclear factor Y, subunit A6(NF-YA6) | coding protein | psRNATarget | |||||||||
AY140028.1 |
|
1.0 | Arabidopsis thaliana CCAAT-binding factor B subunit-like protein, putative (At1g72830) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
Y13722.1 |
|
1.0 | Arabidopsis thaliana mRNA for Hap2c transcription factor | NA | coding protein | psRNATarget | |||||||||
NM_001334553.1 |
|
1.0 | Arabidopsis thaliana nuclear factor Y, subunit A3 (NF-YA3), mRNA | nuclear factor Y, subunit A3(NF-YA3) | coding protein | psRNATarget | |||||||||
AY057539.1 |
|
1.0 | Arabidopsis thaliana At1g72830/F3N23_3 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_001036195.5 |
|
1.0 | Arabidopsis thaliana nuclear factor Y, subunit A3 (NF-YA3), mRNA | nuclear factor Y, subunit A3(NF-YA3) | coding protein | psRNATarget | |||||||||
NM_105941.8 |
|
1.0 | Arabidopsis thaliana nuclear factor Y, subunit A3 (NF-YA3), mRNA | nuclear factor Y, subunit A3(NF-YA3) | coding protein | psRNATarget | |||||||||
BX813919.1 |
|
2.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB47ZG01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY088950.1 |
|
2.0 | Arabidopsis thaliana clone 106674 mRNA, complete sequence | NA | coding protein | psRNATarget | |||||||||
NM_202121.2 |
|
2.0 | Arabidopsis thaliana nuclear factor Y, subunit A8 (NF-YA8), mRNA | nuclear factor Y, subunit A8(NF-YA8) | coding protein | psRNATarget | |||||||||
NM_101621.3 |
|
2.0 | Arabidopsis thaliana nuclear factor Y, subunit A8 (NF-YA8), mRNA | nuclear factor Y, subunit A8(NF-YA8) | coding protein | psRNATarget | |||||||||
NM_001198095.1 |
|
2.0 | Arabidopsis thaliana nuclear factor Y, subunit A8 (NF-YA8), mRNA | nuclear factor Y, subunit A8(NF-YA8) | coding protein | psRNATarget | |||||||||
BX815988.1 |
|
2.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH20ZH03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
NM_202122.2 |
|
2.0 | Arabidopsis thaliana nuclear factor Y, subunit A8 (NF-YA8), mRNA | nuclear factor Y, subunit A8(NF-YA8) | coding protein | psRNATarget |
1 | PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004). |
2 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
3 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
4 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
5 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |