ncRNA ID | ath-miR173-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr3:8236153-8236254 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 75 - UGAUUCUCUGUGUAAGCGAAA - 95 |
Stem-loop(if miRNA) |
     A            G      A      U  UCAAAAAAG   U  U UAAGU CUUUCGCUUGCA AGAGAA UCACAG GG         UUG AG U ||||| |||||||||||| |||||| |||||| ||         ||| || GUUCG GAAAGCGAAUGU UCUCUU AGUGUC CC         AAU UC U      A            G      -      U  UUUCUCUGA   -  U |
Stem-loop sequence | UAAGUACUUUCGCUUGCAGAGAGAAAUCACAGUGGUCAAAAAAGUUGUAGUUUUCUUAAAGUCUCUUUCCUCUGUGAUUCUCUGUGUAAGCGAAAGAGCUUG |
1 | PMID:12225663
"CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana"; Park W, Li J, Song R, Messing J, Chen X; Curr Biol. 12:1484-1495(2002). |
2 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
3 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
4 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
5 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |
6 | PMID:22221297
"Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology"; Zhang B, Xie D, Jin Z; J Integr Plant Biol. 54:73-86(2012). |