Search result

BaseInfo

ncRNA ID ath-miR173-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr3:8236153-8236254 [+]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 75 - UGAUUCUCUGUGUAAGCGAAA - 95
Stem-loop(if miRNA)      A            G      A      U  UCAAAAAAG   U  U
UAAGU CUUUCGCUUGCA AGAGAA UCACAG GG         UUG AG U
||||| |||||||||||| |||||| |||||| ||         ||| ||
GUUCG GAAAGCGAAUGU UCUCUU AGUGUC CC         AAU UC U
     A            G      -      U  UUUCUCUGA   -  U
Stem-loop sequence UAAGUACUUUCGCUUGCAGAGAGAAAUCACAGUGGUCAAAAAAGUUGUAGUUUUCUUAAAGUCUCUUUCCUCUGUGAUUCUCUGUGUAAGCGAAAGAGCUUG

Reference

1 PMID:12225663
"CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana";
Park W, Li J, Song R, Messing J, Chen X;
Curr Biol. 12:1484-1495(2002).
2 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
3 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
4 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
5 PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis";
Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW;
J Exp Bot. 61:165-177(2010).
6 PMID:22221297
"Global analysis of non-coding small RNAs in Arabidopsis in response to jasmonate treatment by deep sequencing technology";
Zhang B, Xie D, Jin Z;
J Integr Plant Biol. 54:73-86(2012).