ncRNA ID | ath-miR167a-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr3:8108072-8108209 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 101 - GAUCAUGUUCGCAGUUUCACC - 121 |
Stem-loop(if miRNA) |
U     AC   -  U U A         C              -  -  -U     -AU  U    UG    GGUGC  CGG CA C G UGAAGCUGC AGCAUGAUCUAAUU AG CU  UCUUU   CC UUGU  UGU  |||||  ||| || | | ||||||||| |||||||||||||| || ||  |||||   || ||||  ||U  CCACG  GUC GU G C ACUUUGACG UUGUACUAGAUUAG UC GA  AGAGA   GG AGCA  ACU C     CU   A  U C C         C              C  U  CU     AUU  U    GU   |
Stem-loop sequence | UGGUGCACCGGCAUCUGAUGAAGCUGCCAGCAUGAUCUAAUUAGCUUUCUUUAUCCUUUGUUGUGUUUCAUGACGAUGGUUAAGAGAUCAGUCUCGAUUAGAUCAUGUUCGCAGUUUCACCCGUUGACUGUCGCACCC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_119665.3 |
|
1.5 | Arabidopsis thaliana myb domain protein 32 (MYB32), mRNA | myb domain protein 32(MYB32) | coding protein | psRNATarget | |||||||||
AK222112.1 |
|
3.0 | Arabidopsis thaliana mRNA for putative protein, complete cds, clone: RAFL22-91-L07 | NA | coding protein | psRNATarget | |||||||||
NM_126157.4 |
|
3.0 | Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein (DG1), mRNA | Tetratricopeptide repeat (TPR)-like superfamily protein(DG1) | coding protein | psRNATarget | |||||||||
AK229379.1 |
|
3.0 | Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL16-62-L10 | NA | coding protein | psRNATarget |
1 | PMID:12101121
"MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002). |
2 | PMID:12202040
"Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |