ncRNA ID | ath-miR418 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr3:6516218-6516290 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 48 - UAAUGUGAUGAUGAACUGACC - 68 |
Stem-loop(if miRNA) |
     AU    --A   -UA    AAAA   AAA   GA UUUAA  UUAG   AUC   GCGU    AGA   UCC  A |||||  ||||   |||   ||||    |||   ||| AGAUU  AGUC   UAG   UGUA    UCU   AGG  U      CC    AAG   UAG    ---A   -CA   AC |
Stem-loop sequence | UUUAAAUUUAGAAUCUAGCGUAAAAAGAAAAUCCGAAUCAGGAACUCUAAUGUGAUGAUGAACUGACCUUAGA |
1 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
2 | PMID:16669754
"MicroRNAS and their regulatory roles in plants"; Jones-Rhoades MW, Bartel DP, Bartel B; Annu Rev Plant Biol. 57:19-53(2006). |