ncRNA ID | novel_gma_miR6382 |
Species | Glycine max |
Class | miRNA |
Genome position | Chr2:9026111-9026196 [+] |
Reference genome | Glycine_max_v2.0 |
Source | SRR1295521 |
Length | 22 |
Mature sequence(if miRNA) | 65 - CAGAGACCUUUUGAGAAUUAAA - 86 |
Stem-loop(if miRNA) |
--     UC          G          UU          C   UAAUU  CAAAAGGUCU UGUCGUUAAA  UUUUUUAACU U   |||||  |||||||||| ||||||||||  |||||||||| A   AUUAA  GUUUUCCAGA ACGGUAAUUU  AAGAAAUUGA U AA     GA          G          -U          U |
Stem-loop sequence | UAAUUUCCAAAAGGUCUGUGUCGUUAAAUUUUUUUUAACUCUAUUAGUUAAAGAAUUUUAAUGGCAGAGACCUUUUGAGAAUUAAA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_001254594.2 |
|
2.5 | Glycine max biotin carboxyl carrier protein of acetyl-CoA carboxylase 2, chloroplastic-like (LOC100777962), mRNA | biotin carboxyl carrier protein of acetyl-CoA carboxylase 2, chloroplastic-like(LOC100777962) | coding protein | psRNATarget | |||||||||
AK245356.1 |
|
2.5 | Glycine max cDNA, clone: GMFL01-28-C14 | NA | coding protein | psRNATarget |