Search result

BaseInfo

ncRNA ID	novel_gma_miR5886
Species	Glycine max
Class	miRNA
Genome position	Chr11:7680753-7680973 [+]
Reference genome	Glycine_max_v2.0
Source	SRR835767
Length	21
Mature sequence(if miRNA)	1 - UCUCCAUAAGCACUUACAGGA - 21
Stem-loop(if miRNA)	--                CA    -A        ------AC     --U    A      G            A         A        C   A      UAA   CUCUU   UCUCCAUAAGCACUUA  GGAG  AGAAAAUA        AAGUU   AAAU AAUUGG CUUCUUCCAUAA CUAAAAUCA CUUAUGCA UUA UUUUUA   AAG     U   ||||||||||||||||  ||||  ||||||||        |||||   |||| |||||| |||||||||||| ||||||||| |||||||| ||| ||||||   |||     C   AGAGGUAUUCGUGAAU  UCUC  UCUUUUAU        UUUAA   UUUA UUAAUU GAAGGGGGUAUU GAUUUUAGU GGAUACGU AAU GAAAAU   UUC     A UA                -A    CG        CCUACCAU     CAU    C      G            C         C        A   C      UUC   AAUUU
Stem-loop sequence	UCUCCAUAAGCACUUACAGGAGAAGAAAAUAACAAGUUUAAAUAAAUUGGGCUUCUUCCAUAAACUAAAAUCAACUUAUGCACUUAAUUUUUAUAAAAGCUCUUUCAUUUAACUUCUUUAAAAGCUAAAUGCAUAGGCUGAUUUUAGCUUAUGGGGGAAGGUUAAUUCAUUUUACAAUUUUACCAUCCUAUUUUCUGCCUCUAUAAGUGCUUAUGGAGAAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_014776866.1	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ||||*|||||||||||||||= targets:448   UCCUAUAAGUGCUUAUGGAGG   468 Target Full Sequence	2.0	PREDICTED: Glycine max U-box domain-containing protein 35-like (LOC100818628), transcript variant X2, mRNA	U-box domain-containing protein 35-like(LOC100818628)	coding protein	psRNATarget
XM_006573485.2	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ||||||*||||||*||||||| targets:3073   UCCUGUUAGUGCUAAUGGAGA   3093 Target Full Sequence	2.5	PREDICTED: Glycine max histidine kinase 1-like (LOC100814068), transcript variant X2, mRNA	histidine kinase 1-like(LOC100814068)	coding protein	psRNATarget
XM_014775677.1	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ||||||*||||||*||||||| targets:3076   UCCUGUUAGUGCUAAUGGAGA   3096 Target Full Sequence	2.5	PREDICTED: Glycine max histidine kinase 1-like (LOC100814068), transcript variant X1, mRNA	histidine kinase 1-like(LOC100814068)	coding protein	psRNATarget
XM_014774748.1	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   |=|||*||*|||||||||||| targets:796   UUCUGCAAAUGCUUAUGGAGA   816 Target Full Sequence	2.5	PREDICTED: Glycine max LON peptidase N-terminal domain and RING finger protein 1-like (LOC100797798), transcript variant X8, mRNA	LON peptidase N-terminal domain and RING finger protein 1-like(LOC100797798)	coding protein	psRNATarget
XM_014774747.1	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   |=|||*||*|||||||||||| targets:794   UUCUGCAAAUGCUUAUGGAGA   814 Target Full Sequence	2.5	PREDICTED: Glycine max LON peptidase N-terminal domain and RING finger protein 1-like (LOC100797798), transcript variant X7, mRNA	LON peptidase N-terminal domain and RING finger protein 1-like(LOC100797798)	coding protein	psRNATarget
XM_014778757.1	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ***||*||||||||||||||= targets:1224   GGAUGCAAGUGCUUAUGGAGG   1244 Target Full Sequence	3.0	PREDICTED: Glycine max tobamovirus multiplication protein 1-like (LOC100819031), transcript variant X5, mRNA	tobamovirus multiplication protein 1-like(LOC100819031)	coding protein	psRNATarget
XM_006584966.2	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ***||*||||||||||||||= targets:1453   GGAUGCAAGUGCUUAUGGAGG   1473 Target Full Sequence	3.0	PREDICTED: Glycine max tobamovirus multiplication protein 1-like (LOC100819031), transcript variant X2, mRNA	tobamovirus multiplication protein 1-like(LOC100819031)	coding protein	psRNATarget
XM_006584965.2	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ***||*||||||||||||||= targets:1497   GGAUGCAAGUGCUUAUGGAGG   1517 Target Full Sequence	3.0	PREDICTED: Glycine max tobamovirus multiplication protein 1-like (LOC100819031), transcript variant X1, mRNA	tobamovirus multiplication protein 1-like(LOC100819031)	coding protein	psRNATarget
XM_003532604.3	ncRNA:21   AGGACAUUCACGAAUACCUCU   1   ***||*||||||||||||||= targets:1551   GGAUGCAAGUGCUUAUGGAGG   1571 Target Full Sequence	3.0	PREDICTED: Glycine max tobamovirus multiplication protein 1-like (LOC100819031), transcript variant X4, mRNA	tobamovirus multiplication protein 1-like(LOC100819031)	coding protein	psRNATarget