ncRNA ID | novel_gma_miR5866 |
Species | Glycine max |
Class | miRNA |
Genome position | Chr6:19635500-19635598 [+] |
Reference genome | Glycine_max_v2.0 |
Source | SRR835767 |
Length | 24 |
Mature sequence(if miRNA) | 76 - AAAGAAUGAAUGCGUGAAUCGGUU - 99 |
Stem-loop(if miRNA) |
--  U    -     C   GA         CU     U    AG   A   G   CU AUUC UGCAU UCG  CUUUGUUUU  GUUAG CUUU  GCC CUC G   || |||| ||||| |||  |||||||||  ||||| ||||  ||| |||   GG UAAG GCGUA AGU  GAAAUAGGG  UAAUC GAAA  UGG GAG G UU  C    U     -   AA         AU     C    --   -   A |
Stem-loop sequence | CUUAUUCUGCAUCUCGGACUUUGUUUUCUGUUAGUCUUUAGGCCACUCGGGAGAGGGUAAAGCCUAAUUAGGGAUAAAGAAUGAAUGCGUGAAUCGGUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_014765186.1 |
|
2.5 | PREDICTED: Glycine max mitochondrial outer membrane protein porin of 36 kDa-like (LOC100790270), transcript variant X2, mRNA | mitochondrial outer membrane protein porin of 36 kDa-like(LOC100790270) | coding protein | psRNATarget | |||||||||
NM_001255962.2 |
|
2.5 | Glycine max mitochondrial outer membrane protein porin of 36 kDa-like (LOC100790270), mRNA | mitochondrial outer membrane protein porin of 36 kDa-like(LOC100790270) | coding protein | psRNATarget | |||||||||
BT093533.1 |
|
2.5 | Soybean clone JCVI-FLGm-17M16 unknown mRNA | NA | coding protein | psRNATarget |