ncRNA ID | novel_gma_miR5419 |
Species | Glycine max |
Class | miRNA |
Genome position | Chr3:38973721-38973763 [-] |
Reference genome | Glycine_max_v2.0 |
Source | SRR835759 |
Length | 21 |
Mature sequence(if miRNA) | 23 - UUUUAGGAUUGAGUUAGGUUU - 43 |
Stem-loop(if miRNA) |
--     GGA    -          UUUUA   UUGA GUUAGGUU   |||||   |||| |||||||U   AAGGU   AACU CAAUCUAA CU     -AG    U        |
Stem-loop sequence | UUUUAGGAUUGAGUUAGGUUUAAUCUAACUUCAAGAUGGAAUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_014776737.1 |
|
1.5 | PREDICTED: Glycine max S-locus-specific glycoprotein BS29-2-like (LOC106798962), mRNA | S-locus-specific glycoprotein BS29-2-like(LOC106798962) | coding protein | psRNATarget | |||||||||
XM_014774174.1 |
|
2.5 | PREDICTED: Glycine max mediator of RNA polymerase II transcription subunit 25-like (LOC100789451), transcript variant X8, mRNA | mediator of RNA polymerase II transcription subunit 25-like(LOC100789451) | coding protein | psRNATarget |