Search result

BaseInfo

ncRNA ID	ath-miR158a-5p
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr3:3366331-3366430 [-]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	61 - CUUUGUCUACAAUUUUGGAAA - 81
Stem-loop(if miRNA)	-        U U   CUU           A   U     A  UG   A AC ACGUCAUC C GUG   CUUUGUCUACA UUU GGAAA AG  AUG C || |||||||| | |||   ||||||||||| ||| ||||| ||  ||| UG UGUAGUAG G CAU   GAAACAGAUGU AAA CCUUU UC  UAC G   C        U C   AAC           -   C     C  GU   C
Stem-loop sequence	ACACGUCAUCUCUGUGCUUCUUUGUCUACAAUUUUGGAAAAAGUGAUGACGCCAUUGCUCUUUCCCAAAUGUAGACAAAGCAAUACCGUGAUGAUGUCGU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001334112.1	ncRNA:21   AAAGGUUUUAACAUCUGUUUC   1   *||||*||||||*|||||||| targets:1415   AUUCCCAAAUUGCAGACAAAG   1435 Target Full Sequence	2.5	Arabidopsis thaliana hypothetical protein mRNA	hypothetical protein(AT1G63610)	coding protein	psRNATarget
NM_001334111.1	ncRNA:21   AAAGGUUUUAACAUCUGUUUC   1   *||||*||||||*|||||||| targets:1500   AUUCCCAAAUUGCAGACAAAG   1520 Target Full Sequence	2.5	Arabidopsis thaliana hypothetical protein mRNA	hypothetical protein(AT1G63610)	coding protein	psRNATarget
NM_105039.5	ncRNA:21   AAAGGUUUUAACAUCUGUUUC   1   *||||*||||||*|||||||| targets:1472   AUUCCCAAAUUGCAGACAAAG   1492 Target Full Sequence	2.5	Arabidopsis thaliana hypothetical protein mRNA	hypothetical protein(AT1G63610)	coding protein	psRNATarget
BX827566.1	ncRNA:21   AAAGGUUUUAACAUCUGUUUC   1   ***|||||||||*|||||||| targets:36   AACCCAAAAUUGAAGACAAAG   56 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS75ZD05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_101796.2	ncRNA:21   AAAGGUUUUAACAUCUGUUUC   1   ***|||||||||||||*|||| targets:1050   ACGCCAAAAUUGUAGAGAAAG   1070 Target Full Sequence	2.5	Arabidopsis thaliana Wall-associated kinase family protein partial mRNA	Wall-associated kinase family protein(AT1G19390)	coding protein	psRNATarget

Reference

1	PMID:12101121 "MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002).
2	PMID:12202040 "Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002).
3	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
4	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
5	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
6	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).