ncRNA ID | ath-miR158a-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr3:3366331-3366430 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 20 |
Mature sequence(if miRNA) | 19 - UCCCAAAUGUAGACAAAGCA - 38 |
Stem-loop(if miRNA) |
  -        U U   CUU           A   U     A  UG   A AC ACGUCAUC C GUG   CUUUGUCUACA UUU GGAAA AG  AUG C || |||||||| | |||   ||||||||||| ||| ||||| ||  ||| UG UGUAGUAG G CAU   GAAACAGAUGU AAA CCUUU UC  UAC G   C        U C   AAC           -   C     C  GU   C |
Stem-loop sequence | ACACGUCAUCUCUGUGCUUCUUUGUCUACAAUUUUGGAAAAAGUGAUGACGCCAUUGCUCUUUCCCAAAUGUAGACAAAGCAAUACCGUGAUGAUGUCGU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_103878.2 |
|
2.5 | Arabidopsis thaliana Transducin/WD40 repeat-like superfamily protein (BUB3.2), mRNA | Transducin/WD40 repeat-like superfamily protein(BUB3.2) | coding protein | psRNATarget | |||||||||
NM_001334145.1 |
|
2.5 | Arabidopsis thaliana pentatricopeptide (PPR) repeat-containing protein partial mRNA | pentatricopeptide (PPR) repeat-containing protein(AT1G64100) | coding protein | psRNATarget | |||||||||
NM_001084301.1 |
|
2.5 | Arabidopsis thaliana pentatricopeptide (PPR) repeat-containing protein partial mRNA | pentatricopeptide (PPR) repeat-containing protein(AT1G64100) | coding protein | psRNATarget | |||||||||
DQ446393.1 |
|
2.5 | Arabidopsis thaliana clone pENTR221-At1g64100 pentatricopeptide repeat-containing protein (At1g64100) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_105083.1 |
|
2.5 | Arabidopsis thaliana pentatricopeptide (PPR) repeat-containing protein partial mRNA | pentatricopeptide (PPR) repeat-containing protein(AT1G64100) | coding protein | psRNATarget |
1 | PMID:12101121
"MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002). |
2 | PMID:12202040
"Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |