ncRNA ID | ath-miR2111a-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr3:2854284-2854442 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 28 - UAAUCUGCAUCCUGAGGUUUA - 48 |
Stem-loop(if miRNA) |
   UG   A      ---        C                    U     --  UUAAUUUACGCAGGAAAUUUGUAU CGA  AUG GUAUUG   GUGAGGAC GGGUAAUCUGCAUCCUGAGG UUAAA  GC                        A |||  ||| ||||||   |||||||| |||||||||||||||||||| |||||  || GCU  UGC CAUAAC   CAUUCUUG UCCAUUAGGCGUAGGGCUCC GAUUU  CA                        C    CA   A      AUU        C                    U     UC  UAUGAUUAUGUGUAUGCAUAUACG |
Stem-loop sequence | CGAUGAUGAGUAUUGGUGAGGACCGGGUAAUCUGCAUCCUGAGGUUUAAAGCUUAAUUUACGCAGGAAAUUUGUAUACGCAUAUACGUAUGUGUAUUAGUAUACCUUUUAGUCCUCGGGAUGCGGAUUACCUCGUUCUUACUUACAAUACACGUACUCG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_113629.3 |
|
1.0 | Arabidopsis thaliana Galactose oxidase/kelch repeat superfamily protein mRNA | Galactose oxidase/kelch repeat superfamily protein(AT3G27150) | coding protein | psRNATarget | |||||||||
NM_001338859.1 |
|
1.0 | Arabidopsis thaliana Galactose oxidase/kelch repeat superfamily protein mRNA | Galactose oxidase/kelch repeat superfamily protein(AT3G27150) | coding protein | psRNATarget | |||||||||
BT008476.1 |
|
2.5 | Arabidopsis thaliana At1g07010 gene, complete cds | NA | coding protein | psRNATarget | |||||||||
BX815035.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS26ZE01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY136428.1 |
|
2.5 | Arabidopsis thaliana unknown protein (At1g07010) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX815748.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS90ZA04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY079027.1 |
|
2.5 | Arabidopsis thaliana At1g07010/F10K1_19 mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_001160844.1 |
|
2.5 | Arabidopsis thaliana Calcineurin-like metallo-phosphoesterase superfamily protein (SLP1), mRNA | Calcineurin-like metallo-phosphoesterase superfamily protein(SLP1) | coding protein | psRNATarget | |||||||||
NM_001123768.1 |
|
2.5 | Arabidopsis thaliana Calcineurin-like metallo-phosphoesterase superfamily protein (SLP1), mRNA | Calcineurin-like metallo-phosphoesterase superfamily protein(SLP1) | coding protein | psRNATarget | |||||||||
NM_100574.5 |
|
2.5 | Arabidopsis thaliana Calcineurin-like metallo-phosphoesterase superfamily protein (SLP1), mRNA | Calcineurin-like metallo-phosphoesterase superfamily protein(SLP1) | coding protein | psRNATarget |
1 | PMID:19307293
"Computational and analytical framework for small RNA profiling by high-throughput sequencing"; Fahlgren N, Sullivan CM, Kasschau KD, Chapman EJ, Cumbie JS, Montgomery TA, Gilbert SD, Dasenko M, Backman TW, Givan SA, Carrington JC; RNA. 15:992-1002(2009). |
2 | PMID:19465578
"Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing"; Pant BD, Musialak-Lange M, Nuc P, May P, Buhtz A, Kehr J, Walther D, Scheible WR; Plant Physiol. 150:1541-1555(2009). |
3 | PMID:19854858
"Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing"; Hsieh LC, Lin SI, Shih AC, Chen JW, Lin WY, Tseng CY, Li WH, Chiou TJ; Plant Physiol. 151:2120-2132(2009). |