Search result

BaseInfo

ncRNA ID	novel_gma_miR4129
Species	Glycine max
Class	miRNA
Genome position	Chr16:4921464-4921663 [+]
Reference genome	Glycine_max_v2.0
Source	SRR1753107
Length	19
Mature sequence(if miRNA)	182 - UGAAUAUAUUUGUCGCACU - 200
Stem-loop(if miRNA)	--UA            CU   C      AA       C      U       AUU   -AA       UAAUGAU  C       UUUUG     A    AUC     CGACAAAUAUAU  GGA GUUAAU  UAGAUUG GAUUAA UAUUAUA   UAA   AAAUUUA       UA AACAAAA     AGAGA UUAU   A     ||||||||||||  ||| ||||||  ||||||| |||||| |||||||   |||   |||||||       || |||||||     ||||| ||||   U     GCUGUUUAUAUA  UUU CAAUUA  AUCUAAC CUGAUU AUAAUAU   AUU   UUUGAAU       AU UUGUUUU     UUUCU AAUG   A UCAC            AG   A      GC       U      U       ---   GCG       UUAUAAU  A       ---UA     G    AUC
Stem-loop sequence	UACGACAAAUAUAUCUGGACGUUAAUAAUAGAUUGCGAUUAAUUAUUAUAAUUUAAAAAAAUUUAUAAUGAUUACAACAAAAUUUUGAGAGAAUUAUAUCAUACUAGUAAGUCUUUAUUUUUGUUAUAUAAUAUUUAAGUUUGCGUUAUAUAAUAUUUAGUCUCAAUCUACGAUUAACAUUUGAAUAUAUUUGUCGCACU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003531341.3	ncRNA:19   UCACGCUGUUUAUAUAAGU   1   |||||*||||||||||||= targets:694   AGUGCCACAAAUAUAUUCG   712 Target Full Sequence	2.0	PREDICTED: Glycine max mediator of RNA polymerase II transcription subunit 28-like (LOC100789247), mRNA	mediator of RNA polymerase II transcription subunit 28-like(LOC100789247)	coding protein	psRNATarget
XM_014772481.1	ncRNA:19   UCACGCUGUUUAUAUAAGU   1   ||||=*||||||||||||= targets:1299   AGUGUAACAAAUAUAUUCG   1317 Target Full Sequence	3.0	PREDICTED: Glycine max signal recognition particle receptor subunit alpha homolog (LOC100788753), mRNA	signal recognition particle receptor subunit alpha homolog(LOC100788753)	coding protein	psRNATarget
XM_014779521.1	ncRNA:19   UCACGCUGUUUAUAUAAGU   1   ||*|=|||||||||||||* targets:1953   AGCGUGACAAAUAUAUUCC   1971 Target Full Sequence	3.0	PREDICTED: Glycine max chloroplast envelope membrane protein-like (LOC100799467), transcript variant X3, mRNA	chloroplast envelope membrane protein-like(LOC100799467)	coding protein	psRNATarget
XM_006586212.2	ncRNA:19   UCACGCUGUUUAUAUAAGU   1   ||*|=|||||||||||||* targets:2127   AGCGUGACAAAUAUAUUCC   2145 Target Full Sequence	3.0	PREDICTED: Glycine max chloroplast envelope membrane protein-like (LOC100799467), transcript variant X2, mRNA	chloroplast envelope membrane protein-like(LOC100799467)	coding protein	psRNATarget
XM_003532269.3	ncRNA:19   UCACGCUGUUUAUAUAAGU   1   ||*|=|||||||||||||* targets:2127   AGCGUGACAAAUAUAUUCC   2145 Target Full Sequence	3.0	PREDICTED: Glycine max chloroplast envelope membrane protein-like (LOC100799467), transcript variant X1, mRNA	chloroplast envelope membrane protein-like(LOC100799467)	coding protein	psRNATarget