Search result

BaseInfo

ncRNA ID ath-miR403-5p
Species Arabidopsis thaliana
Class miRNA
Genome position chr2:19415052-19415186 [+]
Reference genome TAIR10
Source miRBase
Length 22
Mature sequence(if miRNA) 26 - UGUUUUGUGCUUGAAUCUAAUU - 47
Stem-loop(if miRNA) UUGUCAUUAGA    U  U     AU    U    U                -G  UUUAUGUAAGAGAUUCU
           AGAG CG AUUAC  GUUU GUGC UGAAUCUAAUUCAACA  GC                 U
           |||| || |||||  |||| |||| ||||||||||||||||  ||
           UUUC GU UAAUG  CAAA CACG ACUUAGAUUAGGUUGU  UU                 U
-----------    U  C     CU    -    C                UG  UCUAAUAUCCUUAACAA
Stem-loop sequence UUGUCAUUAGAAGAGUCGUAUUACAUGUUUUGUGCUUGAAUCUAAUUCAACAGGCUUUAUGUAAGAGAUUCUUUAACAAUUCCUAUAAUCUUUGUUGUUGGAUUAGAUUCACGCACAAACUCGUAAUCUGUCUUU

Reference

1 PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis";
Sunkar R, Zhu JK;
Plant Cell. 16:2001-2019(2004).
2 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
3 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
4 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
5 PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis";
Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW;
J Exp Bot. 61:165-177(2010).