ncRNA ID | ath-miR408-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:19319814-19320031 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 53 - ACAGGGAACAAGCAGAGCAUG - 73 |
Stem-loop(if miRNA) |
AAG     AUU    UU         --GAAGAC     --G U     ---        --------------------------       CAA    A      AUU   UUUAC       UUAA    GUUAG   GGUA  GCAAUGAAA        AAAGC   G AAUGA   GAGAGAGA                          CAGGGAA   GCAG GCAUGG   GAG     UAAAACA    A    |||||   ||||  |||||||||        |||||   | |||||   ||||||||                          |||||||   |||| ||||||   |||     |||||||    C    CAAUC   UCAU  CGUUAUUUU        UUUCG   C UUACU   CUCUCUCU                          GUCCCUU   CGUC CGUACC   CUC     GUUUUGU    G --G     --G    --         AAGGUAAC     ACA U     UUC        CUUUAUAUCUCUUUUUUUCUCCCUCG       CUC    A      CAU   ----U       CUCA |
Stem-loop sequence | AAGGUUAGAUUGGUAUUGCAAUGAAAGAAGACAAAGCGGUAAUGAGAGAGAGACAGGGAACAAGCAGAGCAUGGAUUGAGUUUACUAAAACAUUAAACGACUCUGUUUUGUCUCUACCCAUGCACUGCCUCUUCCCUGGCUCCCUCUUUUUUUCUCUAUAUUUCUCUCUCUCCUUUCAUUUCACAGCUUUCAAUGGAAUUUUAUUGCUACUGCUAACG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_130270.4 |
|
0.0 | Arabidopsis thaliana Peptide chain release factor 1 mRNA | Peptide chain release factor 1(AT2G47020) | coding protein | psRNATarget | |||||||||
BX818937.1 |
|
0.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB29ZC05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AK228004.1 |
|
0.0 | Arabidopsis thaliana mRNA for putative peptide chain release factor, complete cds, clone: RAFL14-53-C21 | NA | coding protein | psRNATarget |
1 | PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis"; Sunkar R, Zhu JK; Plant Cell. 16:2001-2019(2004). |
2 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
3 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
4 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |
5 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |