ncRNA ID | ath-miR166a-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:19176108-19176277 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 21 - GGACUGUUGUCUGGCUCGAGG - 41 |
Stem-loop(if miRNA) |
-A     UUUCU UU   A     C  UU      CU       U    CUC      U   -----   --    UCUCUUUCGAUCUA   GGGGC     C  UUG GGGGA UG  GUCUGG  CGAGGAC CUGG   GCUCUA UCA     UGU  UGGA              A   |||||     |  ||| ||||| ||  ||||||  ||||||| ||||   |||||| |||     |||  ||||              C   CCUCG     G  AAC CCCCU AC  CGGACC  GCUUCUG GAUU   UGGGAU AGU     CUU  GACU              A UC     ---UU UU   C     U  UU      AG       C    --U      U   UUAGA   UA    UCCAAGUUAAGCUA |
Stem-loop sequence | AGGGGCUUUCUCUUUUGAGGGGACUGUUGUCUGGCUCGAGGACUCUGGCUCGCUCUAUUCAUGUUGGAUCUCUUUCGAUCUAACAAUCGAAUUGAACCUUCAGAUUUCAGAUUUGAUUAGGGUUUUAGCGUCUUCGGACCAGGCUUCAUUCCCCCCAAUUGUUGCUCCCU |
1 | PMID:12101121
"MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002). |
2 | PMID:12202040
"Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |
7 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |