Search result

BaseInfo

ncRNA ID	novel_gma_miR3609
Species	Glycine max
Class	miRNA
Genome position	Chr6:10306236-10306301 [+]
Reference genome	Glycine_max_v2.0
Source	SRR1451676
Length	21
Mature sequence(if miRNA)	46 - UAGAAAGAGAGAGAGAAAGAG - 66
Stem-loop(if miRNA)	----G       A      -C     UU  UU        UUUCUUU UCUUUU  UAAUA  GA  ACU      ||||||| ||||||  |||||  ||  ||G      AGAGAGA AGAAAG  GUUAU  CU  UGG GAGAA       G      AU     UU  UC
Stem-loop sequence	GUUUCUUUAUCUUUUCUAAUAUUGAUUACUGGGUCUUCUUUAUUGUAGAAAGAGAGAGAGAAAGAG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003542620.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||||||| targets:117   UUCUUUCUCUCUCUCUUUCUA   137 Target Full Sequence	0.0	PREDICTED: Glycine max probable protein phosphatase 2C 27 (LOC100782648), mRNA	probable protein phosphatase 2C 27(LOC100782648)	coding protein	psRNATarget
XM_014773056.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||=|||||||||||||| targets:45   CUCUUUUUCUCUCUCUUUCUA   65 Target Full Sequence	1.0	PREDICTED: Glycine max exonuclease 3'-5' domain-containing protein 1-like (LOC100794813), transcript variant X1, mRNA	exonuclease 3'-5' domain-containing protein 1-like(LOC100794813)	coding protein	psRNATarget
XM_006599350.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||||||* targets:29   CUCUUUCUCUCUCUCUUUCUC   49 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC102660655 (LOC102660655), transcript variant X1, mRNA	uncharacterized LOC102660655(LOC102660655)	coding protein	psRNATarget
XM_006599351.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||||||* targets:29   CUCUUUCUCUCUCUCUUUCUC   49 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC102660655 (LOC102660655), transcript variant X2, mRNA	uncharacterized LOC102660655(LOC102660655)	coding protein	psRNATarget
XM_006599352.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||||||* targets:29   CUCUUUCUCUCUCUCUUUCUC   49 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC102660655 (LOC102660655), transcript variant X3, mRNA	uncharacterized LOC102660655(LOC102660655)	coding protein	psRNATarget
XM_003538343.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||||||* targets:34   CUCUUUCUCUCUCUCUUUCUC   54 Target Full Sequence	1.0	PREDICTED: Glycine max protein ODORANT1 (LOC100803624), mRNA	protein ODORANT1(LOC100803624)	coding protein	psRNATarget
XM_006583765.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||||||* targets:799   UUCUUUCUCUCUCUCUUUCUU   819 Target Full Sequence	1.0	PREDICTED: Glycine max protein SMG7L-like (LOC100786043), transcript variant X5, mRNA	protein SMG7L-like(LOC100786043)	coding protein	psRNATarget
XM_003556090.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||| targets:194   CUCUCUCUCUCUCUCUUUCUA   214 Target Full Sequence	1.0	PREDICTED: Glycine max plastidial pyruvate kinase 2 (LOC100809327), mRNA	plastidial pyruvate kinase 2(LOC100809327)	coding protein	psRNATarget
AK245792.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||| targets:142   CUCUCUCUCUCUCUCUUUCUA   162 Target Full Sequence	1.0	Glycine max cDNA, clone: GMFL01-41-J24	NA	coding protein	psRNATarget
XM_003516868.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||| targets:314   CUCUCUCUCUCUCUCUUUCUA   334 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100812277 (LOC100812277), mRNA	uncharacterized LOC100812277(LOC100812277)	coding protein	psRNATarget
XM_003518307.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||*|||||||||||||||| targets:2   UUCUGUCUCUCUCUCUUUCUA   22 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized protein At1g65710-like (LOC100788934), mRNA	uncharacterized protein At1g65710-like(LOC100788934)	coding protein	psRNATarget
XM_003550752.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||*|||||||||||||||| targets:41   UUCUCUCUCUCUCUCUUUCUA   61 Target Full Sequence	1.0	PREDICTED: Glycine max probable protein phosphatase 2C 27 (LOC100820303), transcript variant X1, mRNA	probable protein phosphatase 2C 27(LOC100820303)	coding protein	psRNATarget
BT093475.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||*|||||||||||||||| targets:31   UUCUCUCUCUCUCUCUUUCUA   51 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-17G24 unknown mRNA	NA	coding protein	psRNATarget
XM_014770011.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||*|||||||||||||||| targets:42   UUCUCUCUCUCUCUCUUUCUA   62 Target Full Sequence	1.0	PREDICTED: Glycine max probable protein phosphatase 2C 27 (LOC100820303), transcript variant X2, mRNA	probable protein phosphatase 2C 27(LOC100820303)	coding protein	psRNATarget
XM_006576636.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||| targets:48   CUCUUUCUCUCUCUCUCUCUA   68 Target Full Sequence	1.5	PREDICTED: Glycine max eukaryotic translation initiation factor 4G-like (LOC100819084), transcript variant X1, mRNA	eukaryotic translation initiation factor 4G-like(LOC100819084)	coding protein	psRNATarget
XM_006576637.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||| targets:48   CUCUUUCUCUCUCUCUCUCUA   68 Target Full Sequence	1.5	PREDICTED: Glycine max eukaryotic translation initiation factor 4G-like (LOC100819084), transcript variant X2, mRNA	eukaryotic translation initiation factor 4G-like(LOC100819084)	coding protein	psRNATarget
XM_003520359.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||| targets:46   CUCUUUCUCUCUCUCUCUCUA   66 Target Full Sequence	1.5	PREDICTED: Glycine max eukaryotic translation initiation factor 4G-like (LOC100819084), transcript variant X3, mRNA	eukaryotic translation initiation factor 4G-like(LOC100819084)	coding protein	psRNATarget
XM_006573559.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||| targets:220   CUCUUUCUCUCUCUCUCUCUA   240 Target Full Sequence	1.5	PREDICTED: Glycine max LOB domain-containing protein 36-like (LOC102664012), transcript variant X1, mRNA	LOB domain-containing protein 36-like(LOC102664012)	coding protein	psRNATarget
XM_014776110.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||| targets:220   CUCUUUCUCUCUCUCUCUCUA   240 Target Full Sequence	1.5	PREDICTED: Glycine max LOB domain-containing protein 36-like (LOC102664012), transcript variant X4, mRNA	LOB domain-containing protein 36-like(LOC102664012)	coding protein	psRNATarget
XM_003526194.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   |||||||||||||||||||*| targets:61   CUCUUUCUCUCUCUCUUUCAA   81 Target Full Sequence	1.5	PREDICTED: Glycine max RING-H2 finger protein ATL40-like (LOC100783358), mRNA	RING-H2 finger protein ATL40-like(LOC100783358)	coding protein	psRNATarget
XM_006587397.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||*|||| targets:160   UUCUUUCUCUCUCUCUCUCUA   180 Target Full Sequence	1.5	PREDICTED: Glycine max probable serine/threonine protein kinase IREH1 (LOC100776995), mRNA	probable serine/threonine protein kinase IREH1(LOC100776995)	coding protein	psRNATarget
XM_014777897.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||*|||| targets:85   UUCUUUCUCUCUCUCUCUCUA   105 Target Full Sequence	1.5	PREDICTED: Glycine max cyclin-dependent kinase D-3 (LOC100813673), mRNA	cyclin-dependent kinase D-3(LOC100813673)	coding protein	psRNATarget
XM_003546757.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||*|||| targets:140   UUCUUUCUCUCUCUCUCUCUA   160 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100793632 (LOC100793632), mRNA	uncharacterized LOC100793632(LOC100793632)	coding protein	psRNATarget
XM_014767176.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:111   CUCUCUCUCUCUCUCUUUCUG   131 Target Full Sequence	2.0	PREDICTED: Glycine max lysine-specific histone demethylase 1 homolog 3-like (LOC100791869), transcript variant X1, mRNA	lysine-specific histone demethylase 1 homolog 3-like(LOC100791869)	coding protein	psRNATarget
XM_014767177.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:111   CUCUCUCUCUCUCUCUUUCUG   131 Target Full Sequence	2.0	PREDICTED: Glycine max lysine-specific histone demethylase 1 homolog 3-like (LOC100791869), transcript variant X2, mRNA	lysine-specific histone demethylase 1 homolog 3-like(LOC100791869)	coding protein	psRNATarget
XM_014765483.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X7, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014765482.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X6, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_006593983.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X8, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014765478.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X1, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014765479.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X2, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_006593984.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X9, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_003529736.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:137   CUCUCUCUCUCUCUCUUUCUG   157 Target Full Sequence	2.0	PREDICTED: Glycine max plasma membrane ATPase 4-like (LOC100818997), mRNA	plasma membrane ATPase 4-like(LOC100818997)	coding protein	psRNATarget
XM_006593981.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X3, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014774961.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:63   CUCUCUCUCUCUCUCUUUCUG   83 Target Full Sequence	2.0	PREDICTED: Glycine max uncharacterized LOC100818585 (LOC100818585), transcript variant X2, mRNA	uncharacterized LOC100818585(LOC100818585)	coding protein	psRNATarget
XM_003533641.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||* targets:110   CUCUCUCUCUCUCUCUUUCUC   130 Target Full Sequence	2.0	PREDICTED: Glycine max sacsin-like (LOC100789980), mRNA	sacsin-like(LOC100789980)	coding protein	psRNATarget
XM_006593985.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X11, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014765484.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X12, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_003529680.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:29   CUCUCUCUCUCUCUCUUUCUG   49 Target Full Sequence	2.0	PREDICTED: Glycine max protein indeterminate-domain 7 (LOC100785687), transcript variant X1, mRNA	protein indeterminate-domain 7(LOC100785687)	coding protein	psRNATarget
XM_014765481.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X5, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_003542388.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X10, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014765480.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:214   CUCUCUCUCUCUCUCUUUCUG   234 Target Full Sequence	2.0	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X4, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_006582946.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:29   CUCUCUCUCUCUCUCUUUCUG   49 Target Full Sequence	2.0	PREDICTED: Glycine max protein indeterminate-domain 7 (LOC100785687), transcript variant X3, mRNA	protein indeterminate-domain 7(LOC100785687)	coding protein	psRNATarget
XM_003525476.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||= targets:216   CUCUCUCUCUCUCUCUUUCUG   236 Target Full Sequence	2.0	PREDICTED: Glycine max uncharacterized LOC100782442 (LOC100782442), mRNA	uncharacterized LOC100782442(LOC100782442)	coding protein	psRNATarget
XM_003529029.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|=|||||||||||||| targets:84   CUCUCUUUCUCUCUCUUUCUA   104 Target Full Sequence	2.0	PREDICTED: Glycine max pollen-specific protein SF21-like (LOC100782850), transcript variant X1, mRNA	pollen-specific protein SF21-like(LOC100782850)	coding protein	psRNATarget
XM_003551482.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||* targets:77   CUCUCUCUCUCUCUCUUUCUC   97 Target Full Sequence	2.0	PREDICTED: Glycine max Werner Syndrome-like exonuclease (LOC100811403), mRNA	Werner Syndrome-like exonuclease(LOC100811403)	coding protein	psRNATarget
XM_003516366.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||||* targets:112   CUCUCUCUCUCUCUCUUUCUC   132 Target Full Sequence	2.0	PREDICTED: Glycine max protein SCAR2-like (LOC100814240), transcript variant X1, mRNA	protein SCAR2-like(LOC100814240)	coding protein	psRNATarget
XM_014766110.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||=|||||= targets:348   CUCUUUCUCUCUCUUUUUCUG   368 Target Full Sequence	2.5	PREDICTED: Glycine max protein indeterminate-domain 11-like (LOC100819692), mRNA	protein indeterminate-domain 11-like(LOC100819692)	coding protein	psRNATarget
XM_003527590.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:105   CUCUUUCUCUUUCUCUUUCUC   125 Target Full Sequence	2.5	PREDICTED: Glycine max UPF0392 protein At1g27200 (LOC100783546), mRNA	UPF0392 protein At1g27200(LOC100783546)	coding protein	psRNATarget
XM_003524158.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:192   CUCUUUCUCUUUCUCUUUCUC   212 Target Full Sequence	2.5	PREDICTED: Glycine max two-component response regulator ORR24-like (LOC100808625), mRNA	two-component response regulator ORR24-like(LOC100808625)	coding protein	psRNATarget
XM_003548116.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||=|||||||* targets:79   CUCUUUCUCUCUUUCUUUCUU   99 Target Full Sequence	2.5	PREDICTED: Glycine max scarecrow-like protein 8 (LOC100788551), mRNA	scarecrow-like protein 8(LOC100788551)	coding protein	psRNATarget
AK245623.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||=|||||||* targets:48   CUCUUUCUCUCUUUCUUUCUU   68 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-35-P12	NA	coding protein	psRNATarget
XM_003526288.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:111   CUCUUUCUCUUUCUCUUUCUC   131 Target Full Sequence	2.5	PREDICTED: Glycine max probable WRKY transcription factor 31 (LOC100795177), mRNA	probable WRKY transcription factor 31(LOC100795177)	coding protein	psRNATarget
XM_003528233.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:197   CUCUUUCUCUUUCUCUUUCUC   217 Target Full Sequence	2.5	PREDICTED: Glycine max DELLA protein SLR1-like (LOC100814551), mRNA	DELLA protein SLR1-like(LOC100814551)	coding protein	psRNATarget
XM_006600763.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:37   CUCUUUCUCUUUCUCUUUCUC   57 Target Full Sequence	2.5	PREDICTED: Glycine max NAC domain-containing protein 7-like (LOC100797916), mRNA	NAC domain-containing protein 7-like(LOC100797916)	coding protein	psRNATarget
XM_003543426.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:94   CUCUUUCUCUUUCUCUUUCUC   114 Target Full Sequence	2.5	PREDICTED: Glycine max probable serine/threonine-protein kinase RLCKVII (LOC100810614), mRNA	probable serine/threonine-protein kinase RLCKVII(LOC100810614)	coding protein	psRNATarget
XM_003537881.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:116   CUCUUUCUCUUUCUCUUUCUC   136 Target Full Sequence	2.5	PREDICTED: Glycine max probable hydroxyacylglutathione hydrolase 2, chloroplastic (LOC100777052), transcript variant X1, mRNA	probable hydroxyacylglutathione hydrolase 2, chloroplastic(LOC100777052)	coding protein	psRNATarget
XM_003542935.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:218   CUCUUUCUCUUUCUCUUUCUC   238 Target Full Sequence	2.5	PREDICTED: Glycine max trihelix transcription factor ASIL2-like (LOC100815241), mRNA	trihelix transcription factor ASIL2-like(LOC100815241)	coding protein	psRNATarget
XM_014764009.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:115   CUCUUUCUCUUUCUCUUUCUC   135 Target Full Sequence	2.5	PREDICTED: Glycine max probable hydroxyacylglutathione hydrolase 2, chloroplastic (LOC100777052), transcript variant X2, mRNA	probable hydroxyacylglutathione hydrolase 2, chloroplastic(LOC100777052)	coding protein	psRNATarget
NM_001254246.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:48   CUCUUUCUCUUUCUCUUUCUC   68 Target Full Sequence	2.5	Glycine max uncharacterized LOC100783788 (LOC100783788), mRNA	uncharacterized LOC100783788(LOC100783788)	coding protein	psRNATarget
BT097986.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:1156   CUCUUUCUCUUUCUCUUUCUC   1176 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-16B1 unknown mRNA	NA	coding protein	psRNATarget
XM_003543719.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:135   CUCUUUCUCUUUCUCUUUCUU   155 Target Full Sequence	2.5	PREDICTED: Glycine max transcription factor PRE5 (LOC100794486), mRNA	transcription factor PRE5(LOC100794486)	coding protein	psRNATarget
BT099456.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:892   CUCUUUCUCUUUCUCUUUCUC   912 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-23N20 unknown mRNA	NA	coding protein	psRNATarget
XM_003542708.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:92   CUCUUUCUCUUUCUCUUUCUC   112 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100785317 (LOC100785317), mRNA	uncharacterized LOC100785317(LOC100785317)	coding protein	psRNATarget
XM_003544432.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:135   CUCUUUCUCUUUCUCUUUCUC   155 Target Full Sequence	2.5	PREDICTED: Glycine max F-box protein SNE-like (LOC100792219), mRNA	F-box protein SNE-like(LOC100792219)	coding protein	psRNATarget
XM_006597836.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:58   CUCUUUCUCUUUCUCUUUCUC   78 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100779101 (LOC100779101), mRNA	uncharacterized LOC100779101(LOC100779101)	coding protein	psRNATarget
NM_001249932.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:32   CUCUUUCUCUUUCUCUUUCUC   52 Target Full Sequence	2.5	Glycine max uncharacterized LOC100500360 (LOC100500360), mRNA	uncharacterized LOC100500360(LOC100500360)	coding protein	psRNATarget
BT091281.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||=|||||||||* targets:32   CUCUUUCUCUUUCUCUUUCUC   52 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-7H23 unknown mRNA	NA	coding protein	psRNATarget
XM_003543159.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||=|||||= targets:24   UUCUUUCUCUCUCUUUUUCUG   44 Target Full Sequence	2.5	PREDICTED: Glycine max tubby-like F-box protein 7 (LOC100801919), mRNA	tubby-like F-box protein 7(LOC100801919)	coding protein	psRNATarget
AK285256.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||=|||||= targets:19   UUCUUUCUCUCUCUUUUUCUG   39 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-06-A15	NA	coding protein	psRNATarget
XM_014775805.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||=|||||||* targets:45   UUCUUUCUCUCUUUCUUUCUC   65 Target Full Sequence	2.5	PREDICTED: Glycine max protein MEI2-like 4 (LOC106798747), transcript variant X1, mRNA	protein MEI2-like 4(LOC106798747)	coding protein	psRNATarget
XM_014775809.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||=|||||||* targets:45   UUCUUUCUCUCUUUCUUUCUC   65 Target Full Sequence	2.5	PREDICTED: Glycine max protein MEI2-like 4 (LOC106798747), transcript variant X5, mRNA	protein MEI2-like 4(LOC106798747)	coding protein	psRNATarget
XM_014775810.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||=|||||||* targets:45   UUCUUUCUCUCUUUCUUUCUC   65 Target Full Sequence	2.5	PREDICTED: Glycine max protein MEI2-like 4 (LOC106798747), transcript variant X6, mRNA	protein MEI2-like 4(LOC106798747)	coding protein	psRNATarget
XM_014775811.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||=|||||||* targets:45   UUCUUUCUCUCUUUCUUUCUC   65 Target Full Sequence	2.5	PREDICTED: Glycine max protein MEI2-like 4 (LOC106798747), transcript variant X7, mRNA	protein MEI2-like 4(LOC106798747)	coding protein	psRNATarget
XM_014775808.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||=|||||||* targets:45   UUCUUUCUCUCUUUCUUUCUC   65 Target Full Sequence	2.5	PREDICTED: Glycine max protein MEI2-like 4 (LOC106798747), transcript variant X4, mRNA	protein MEI2-like 4(LOC106798747)	coding protein	psRNATarget
XM_003538102.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||=|||||||||* targets:149   UUCUUUCUCUUUCUCUUUCUU   169 Target Full Sequence	2.5	PREDICTED: Glycine max homeobox-leucine zipper protein REVOLUTA-like (LOC100804870), mRNA	homeobox-leucine zipper protein REVOLUTA-like(LOC100804870)	coding protein	psRNATarget
XM_006604032.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||=|||||||* targets:822   UUCUUUCUCUCUUUCUUUCUU   842 Target Full Sequence	2.5	PREDICTED: Glycine max kinase D-interacting substrate of 220 kDa-like (LOC100805213), mRNA	kinase D-interacting substrate of 220 kDa-like(LOC100805213)	coding protein	psRNATarget
XM_006587344.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||||=|* targets:186   UUCUUUCUCUCUCUCUUUUUU   206 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100787320 (LOC100787320), transcript variant X1, mRNA	uncharacterized LOC100787320(LOC100787320)	coding protein	psRNATarget
XM_006587345.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||||||||||=|* targets:185   UUCUUUCUCUCUCUCUUUUUU   205 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100787320 (LOC100787320), transcript variant X2, mRNA	uncharacterized LOC100787320(LOC100787320)	coding protein	psRNATarget
XM_014768853.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||=|||||| targets:362   CUCUCUCUCUCUCUUUUUCUA   382 Target Full Sequence	2.5	PREDICTED: Glycine max 1-phosphatidylinositol-3-phosphate 5-kinase FAB1B-like (LOC100777340), transcript variant X2, mRNA	1-phosphatidylinositol-3-phosphate 5-kinase FAB1B-like(LOC100777340)	coding protein	psRNATarget
XM_003520115.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||=|||||||||||* targets:12   UUCUUUCUUUCUCUCUUUCUU   32 Target Full Sequence	2.5	PREDICTED: Glycine max protein POLLENLESS 3-LIKE 2 (LOC100803414), mRNA	protein POLLENLESS 3-LIKE 2(LOC100803414)	coding protein	psRNATarget
XM_014767907.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:37   CUCUCUCUCUCUCUCUUUUUA   57 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100796804 (LOC100796804), transcript variant X3, mRNA	uncharacterized LOC100796804(LOC100796804)	coding protein	psRNATarget
XM_006597246.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:37   CUCUCUCUCUCUCUCUUUUUA   57 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100796804 (LOC100796804), transcript variant X1, mRNA	uncharacterized LOC100796804(LOC100796804)	coding protein	psRNATarget
XM_014767908.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:37   CUCUCUCUCUCUCUCUUUUUA   57 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100796804 (LOC100796804), transcript variant X5, mRNA	uncharacterized LOC100796804(LOC100796804)	coding protein	psRNATarget
XM_014767909.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:37   CUCUCUCUCUCUCUCUUUUUA   57 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100796804 (LOC100796804), transcript variant X6, mRNA	uncharacterized LOC100796804(LOC100796804)	coding protein	psRNATarget
XM_014767923.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:92   CUCUUUCUCUCUCUCUCUCUG   112 Target Full Sequence	2.5	PREDICTED: Glycine max serine/threonine-protein kinase D6PKL2-like (LOC100781600), mRNA	serine/threonine-protein kinase D6PKL2-like(LOC100781600)	coding protein	psRNATarget
XM_014772903.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:254   CUCUCUCUCUCUCUCUUUUUA   274 Target Full Sequence	2.5	PREDICTED: Glycine max beta-glucuronosyltransferase GlcAT14A-like (LOC100796734), mRNA	beta-glucuronosyltransferase GlcAT14A-like(LOC100796734)	coding protein	psRNATarget
XM_003555880.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:62   CUCUCUCUCUCUCUCUUUUUA   82 Target Full Sequence	2.5	PREDICTED: Glycine max CDP-diacylglycerol--serine O-phosphatidyltransferase 1 (LOC100787048), transcript variant X1, mRNA	CDP-diacylglycerol--serine O-phosphatidyltransferase 1(LOC100787048)	coding protein	psRNATarget
XM_006583072.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:91   CUCUUUCUCUCUCUCUGUCUG   111 Target Full Sequence	2.5	PREDICTED: Glycine max cyclin-A2-4-like (LOC100789757), mRNA	cyclin-A2-4-like(LOC100789757)	coding protein	psRNATarget
AK246068.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||||||=|| targets:325   CUCUCUCUCUCUCUCUUUUUA   345 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-50-L22	NA	coding protein	psRNATarget
XM_003541475.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:369   CUCUUUCUCUCUCUCUCUCUG   389 Target Full Sequence	2.5	PREDICTED: Glycine max NAC domain-containing protein 73-like (LOC100783888), mRNA	NAC domain-containing protein 73-like(LOC100783888)	coding protein	psRNATarget
XM_003548084.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   |||||||||*||||||||||= targets:1311   CUCUUUCUCCCUCUCUUUCUG   1331 Target Full Sequence	2.5	PREDICTED: Glycine max probable membrane-associated kinase regulator 6 (LOC100816359), mRNA	probable membrane-associated kinase regulator 6(LOC100816359)	coding protein	psRNATarget
BT099166.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   =|||||||||=|||||||||* targets:610   UUCUUUCUCUUUCUCUUUCUU   630 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-26H18 unknown mRNA	NA	coding protein	psRNATarget
XM_006597873.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||* targets:3032   CUCUUUCUCUCUCUCUCUCUC   3052 Target Full Sequence	2.5	PREDICTED: Glycine max CTD small phosphatase-like protein 2 (LOC100799803), transcript variant X1, mRNA	CTD small phosphatase-like protein 2(LOC100799803)	coding protein	psRNATarget
BT094592.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:1478   CUCUUUCUCUCUCUCUGUCUG   1498 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-24N22 unknown mRNA	NA	coding protein	psRNATarget
BT097169.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:24   CUCUUUCUCUCUCUCUCUCUG   44 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-26E17 unknown mRNA	NA	coding protein	psRNATarget
XM_003534471.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:106   CUCUUUCUCUCUCUCUCUCUG   126 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100787156 (LOC100787156), mRNA	uncharacterized LOC100787156(LOC100787156)	coding protein	psRNATarget
XM_003554235.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||||*|= targets:295   CUCUUUCUCUCUCUCUUUGUG   315 Target Full Sequence	2.5	PREDICTED: Glycine max LOB domain-containing protein 16-like (LOC100801508), mRNA	LOB domain-containing protein 16-like(LOC100801508)	coding protein	psRNATarget
AK285430.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||=|||||||||*|||| targets:13   CUCUUUUUCUCUCUCUCUCUA   33 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-09-H15	NA	coding protein	psRNATarget
XM_003530550.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:196   CUCUUUCUCUCUCUCUCUCUG   216 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100807973 (LOC100807973), mRNA	uncharacterized LOC100807973(LOC100807973)	coding protein	psRNATarget
XM_014766275.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||= targets:878   CUCUUUCUCUCUCUCUCUCUG   898 Target Full Sequence	2.5	PREDICTED: Glycine max probably inactive leucine-rich repeat receptor-like protein kinase At5g48380 (LOC106795643), mRNA	probably inactive leucine-rich repeat receptor-like protein kinase At5g48380(LOC106795643)	coding protein	psRNATarget
NM_001252778.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||=|||||| targets:658   CUCUCUCUCUCUCUUUUUCUA   678 Target Full Sequence	2.5	Glycine max uncharacterized LOC100796944 (LOC100796944), mRNA	uncharacterized LOC100796944(LOC100796944)	coding protein	psRNATarget
BT097731.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||||||||=|||||| targets:658   CUCUCUCUCUCUCUUUUUCUA   678 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-22B5 unknown mRNA	NA	coding protein	psRNATarget
AK286153.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||=|||||||||||| targets:20   CUCUCUCUUUCUCUCUUUCUA   40 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-22-M12	NA	coding protein	psRNATarget
NM_001254429.2	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||=|||||||||||| targets:16   CUCUCUCUUUCUCUCUUUCUA   36 Target Full Sequence	2.5	Glycine max ubiquitin-conjugating enzyme E2 10-like (LOC100806349), mRNA	ubiquitin-conjugating enzyme E2 10-like(LOC100806349)	coding protein	psRNATarget
XM_003541060.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||* targets:339   CUCUUUCUCUCUCUCUGUCUU   359 Target Full Sequence	2.5	PREDICTED: Glycine max myosin-2-like (LOC100802074), mRNA	myosin-2-like(LOC100802074)	coding protein	psRNATarget
XM_003541811.3	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||* targets:365   CUCUUUCUCUCUCUCUCUCUC   385 Target Full Sequence	2.5	PREDICTED: Glycine max myosin-2-like (LOC100819335), mRNA	myosin-2-like(LOC100819335)	coding protein	psRNATarget
AK244128.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||*|||=|||||||||||| targets:17   CUCUCUCUUUCUCUCUUUCUA   37 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-02-C18	NA	coding protein	psRNATarget
XM_014764627.1	ncRNA:21   GAGAAAGAGAGAGAGAAAGAU   1   ||||||||||||||||*|||* targets:62   CUCUUUCUCUCUCUCUCUCUC   82 Target Full Sequence	2.5	PREDICTED: Glycine max serine/threonine-protein phosphatase BSL3-like (LOC100788485), transcript variant X1, mRNA	serine/threonine-protein phosphatase BSL3-like(LOC100788485)	coding protein	psRNATarget
BT099101.1	ncRNA:21   GAGAAAGAGAGAG-AGAAAGAU   1   |||||||||||||-|||||||| targets:1339   CUCUUUCUCUCUCCUCUUUCUA   1360 Target Full Sequence	3.0	Soybean clone JCVI-FLGm-23J23 unknown mRNA	NA	coding protein	psRNATarget
XM_014771081.1	ncRNA:21   GAGA-AAGAGAGAGAGAAAGAU   1   ||||-||||||||||||||||* targets:450   CUCUCUUCUCUCUCUCUUUCUU   471 Target Full Sequence	3.0	PREDICTED: Glycine max kinesin-like protein KIN12B (LOC100790375), mRNA	kinesin-like protein KIN12B(LOC100790375)	coding protein	psRNATarget
XM_006581781.2	ncRNA:21   GAGAA-AGAGAGAGAGAAAGAU   1   |||||-|||||||||||||||* targets:32   CUCUUCUCUCUCUCUCUUUCUU   53 Target Full Sequence	3.0	PREDICTED: Glycine max chaperone protein ClpC, chloroplastic (LOC100804035), transcript variant X1, mRNA	chaperone protein ClpC, chloroplastic(LOC100804035)	coding protein	psRNATarget
XM_006603688.2	ncRNA:21   GAGAA-AGAGAGAGAGAAAGAU   1   |||||-|||||||||||||||* targets:90   CUCUUCUCUCUCUCUCUUUCUC   111 Target Full Sequence	3.0	PREDICTED: Glycine max glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform-like (LOC100817852), transcript variant X1, mRNA	glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform-like(LOC100817852)	coding protein	psRNATarget
XM_014771368.1	ncRNA:21   GAGAA-AGAGAGAGAGAAAGAU   1   |||||-|||||||||||||||* targets:64   CUCUUCUCUCUCUCUCUUUCUC   85 Target Full Sequence	3.0	PREDICTED: Glycine max glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform-like (LOC100817852), transcript variant X2, mRNA	glucose-6-phosphate 1-dehydrogenase, cytoplasmic isoform-like(LOC100817852)	coding protein	psRNATarget
XM_003533352.3	ncRNA:21   GAGAAA-GAGAGAGAGAAAGAU   1   ||||||-||||||||||||||* targets:1331   CUCUUUUCUCUCUCUCUUUCUU   1352 Target Full Sequence	3.0	PREDICTED: Glycine max ethylene-responsive transcription factor TINY-like (LOC100784134), mRNA	ethylene-responsive transcription factor TINY-like(LOC100784134)	coding protein	psRNATarget