Search result

BaseInfo

ncRNA ID	ath-miR159c
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr2:18994632-18994856 [+]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	195 - UUUGGAUUGAAGGGAGCUCCU - 215
Stem-loop(if miRNA)	GUGUAAC                -C      A         ---CAA   ---UU      CUAAAAU C            U  A   CU     A     A    GCGGUG    A        AGAAGGAGCUCCCUUC  UCCAAA CGAAGAGGA      GAU     GAGGAA       G AGAAUCUAAGAG UC UGU  UCCUC UAGAG GUGC      UUAA A        ||||||||||||||||  |||||| |||||||||      |||     ||||||       | |||||||||||| || |||  ||||| ||||| ||||      ||||        UUUUCCUCGAGGGAAG  AGGUUU GCUUCUCUU      CUA     CUCUUU       C UCUUAGAUUCUC AG ACG  AGGGG AUUUC CACG      AGUU G CUUCUUC                UU      -         CUCUUA   UACAU      ---CUCC -            C  C   UU     A     A    -AAAGA    C
Stem-loop sequence	GUGUAACAGAAGGAGCUCCCUUCCUCCAAAACGAAGAGGACAAGAUUUGAGGAACUAAAAUGCAGAAUCUAAGAGUUCAUGUCUUCCUCAUAGAGAGUGCGCGGUGUUAAAAGCUUGAAGAAAGCACACUUUAAGGGGAUUGCACGACCUCUUAGAUUCUCCCUCUUUCUCUACAUAUCAUUCUCUUCUCUUCGUUUGGAUUGAAGGGAGCUCCUUUUCUUCUUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_128252.6	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||= targets:827   UGGAGCUCCCUUCAUUCCAAG   847 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 104 (MYB104), partial mRNA	myb domain protein 104(MYB104)	coding protein	psRNATarget
AF371979.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   ||*||||||||||||*||||| targets:1169   AGCAGCUCCCUUCAAACCAAA   1189 Target Full Sequence	2.5	Arabidopsis thaliana putative transcription factor MYB120 (MYB120) mRNA, complete cds	NA	coding protein	psRNATarget
NM_124884.2	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   ||*||||||||||||*||||| targets:1339   AGCAGCUCCCUUCAAACCAAA   1359 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 120 (MYB120), partial mRNA	myb domain protein 120(MYB120)	coding protein	psRNATarget
KC544014.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   ||*||||||||||||*||||| targets:1198   AGCAGCUCCCUUCAAACCAAA   1218 Target Full Sequence	2.5	Arabidopsis thaliana transcription factor MYB120 (MYB120) mRNA, complete cds	NA	coding protein	psRNATarget
AF062875.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:717   UGGAGCUCCCUUCAUUCCAAU   737 Target Full Sequence	2.5	Arabidopsis thaliana putative transcription factor (MYB33) mRNA, partial cds	NA	coding protein	psRNATarget
AY519616.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:938   UGGAGCUCCCUUCAUUCCAAU   958 Target Full Sequence	2.5	Arabidopsis thaliana MYB transcription factor (At5g06100) mRNA, complete cds	NA	coding protein	psRNATarget
BT006049.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:938   UGGAGCUCCCUUCAUUCCAAU   958 Target Full Sequence	2.5	Arabidopsis thaliana clone U51311 putative MYB family transcription factor (At5g06100) mRNA, complete cds	NA	coding protein	psRNATarget
AY519585.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:977   UGGAGCUCCCUUCAUUCCAAU   997 Target Full Sequence	2.5	Arabidopsis thaliana MYB transcription factor (At3g11440) mRNA, complete cds	NA	coding protein	psRNATarget
BT005120.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:977   UGGAGCUCCCUUCAUUCCAAU   997 Target Full Sequence	2.5	Arabidopsis thaliana clone U20731 putative Myb DNA-binding protein (At3g11440) mRNA, complete cds	NA	coding protein	psRNATarget
NM_120692.3	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1161   UGGAGCUCCCUUCAUUCCAAU   1181 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 33 (MYB33), mRNA	myb domain protein 33(MYB33)	coding protein	psRNATarget
BX824591.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1153   UGGAGCUCCCUUCAUUCCAAU   1173 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH59ZA07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX822934.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1157   UGGAGCUCCCUUCAUUCCAAU   1177 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB73ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001337927.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1149   UGGAGCUCCCUUCAUUCCAAU   1169 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 65 (MYB65), mRNA	myb domain protein 65(MYB65)	coding protein	psRNATarget
BT003940.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1136   UGGAGCUCCCUUCAUUCCAAU   1156 Target Full Sequence	2.5	Arabidopsis thaliana clone RAFL15-06-P04 (R20731) putative Myb DNA-binding protein (At3g11440) mRNA, complete cds	NA	coding protein	psRNATarget
AF411969.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1066   UGGAGCUCCCUUCAUUCCAAU   1086 Target Full Sequence	2.5	Arabidopsis thaliana putative transcription factor MYB33 (MYB33) mRNA, complete cds	NA	coding protein	psRNATarget
NM_001337926.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1223   UGGAGCUCCCUUCAUUCCAAU   1243 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 65 (MYB65), mRNA	myb domain protein 65(MYB65)	coding protein	psRNATarget
AK118937.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1161   UGGAGCUCCCUUCAUUCCAAU   1181 Target Full Sequence	2.5	Arabidopsis thaliana At5g06100 mRNA for putative transcription factor MYB33, complete cds, clone: RAFL21-27-I01	NA	coding protein	psRNATarget
NM_111977.5	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1212   UGGAGCUCCCUUCAUUCCAAU   1232 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 65 (MYB65), mRNA	myb domain protein 65(MYB65)	coding protein	psRNATarget
NM_180448.2	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1240   UGGAGCUCCCUUCAUUCCAAU   1260 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 33 (MYB33), mRNA	myb domain protein 33(MYB33)	coding protein	psRNATarget
NM_001337925.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1212   UGGAGCUCCCUUCAUUCCAAU   1232 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 65 (MYB65), mRNA	myb domain protein 65(MYB65)	coding protein	psRNATarget
NM_001085068.2	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1321   UGGAGCUCCCUUCAUUCCAAU   1341 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 33 (MYB33), mRNA	myb domain protein 33(MYB33)	coding protein	psRNATarget
NM_001342849.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1498   UGGAGCUCCCUUCAUUCCAAU   1518 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 33 (MYB33), mRNA	myb domain protein 33(MYB33)	coding protein	psRNATarget
NM_001342848.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   *|||||||||||||*|||||* targets:1597   UGGAGCUCCCUUCAUUCCAAU   1617 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 33 (MYB33), mRNA	myb domain protein 33(MYB33)	coding protein	psRNATarget
AY519576.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:896   UAGAGCUUCCUUCAAACCAAA   916 Target Full Sequence	2.5	Arabidopsis thaliana MYB transcription factor (At2g32460) mRNA, complete cds	NA	coding protein	psRNATarget
BT026381.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:896   UAGAGCUUCCUUCAAACCAAA   916 Target Full Sequence	2.5	Arabidopsis thaliana At2g32460 mRNA, complete cds	NA	coding protein	psRNATarget
BX819423.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:977   UAGAGCUUCCUUCAAACCAAA   997 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB76ZG08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX819091.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:985   UAGAGCUUCCUUCAAACCAAA   1005 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB45ZC06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK319141.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:973   UAGAGCUUCCUUCAAACCAAA   993 Target Full Sequence	2.5	Arabidopsis thaliana AT2G32460 mRNA, complete cds, clone: RAFL24-12-E02	NA	coding protein	psRNATarget
AF411970.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:947   UAGAGCUUCCUUCAAACCAAA   967 Target Full Sequence	2.5	Arabidopsis thaliana putative transcription factor MYB101 (MYB101) mRNA, complete cds	NA	coding protein	psRNATarget
NM_001084524.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:972   UAGAGCUUCCUUCAAACCAAA   992 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 101 (MYB101), mRNA	myb domain protein 101(MYB101)	coding protein	psRNATarget
AK229342.1	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:1004   UAGAGCUUCCUUCAAACCAAA   1024 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for putative MYB family transcription factor, complete cds, clone: RAFL16-59-F24	NA	coding protein	psRNATarget
NM_128805.4	ncRNA:21   UCCUCGAGGGAAGUUAGGUUU   1   **|||||=|||||||*||||| targets:1016   UAGAGCUUCCUUCAAACCAAA   1036 Target Full Sequence	2.5	Arabidopsis thaliana myb domain protein 101 (MYB101), mRNA	myb domain protein 101(MYB101)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).