Search result

BaseInfo

ncRNA ID	novel_gma_miR3365
Species	Glycine max
Class	miRNA
Genome position	Chr8:14853422-14853605 [+]
Reference genome	Glycine_max_v2.0
Source	SRR1451672
Length	20
Mature sequence(if miRNA)	1 - UGUGUGUGUGUGUGAGUGAG - 20
Stem-loop(if miRNA)	--      U     U     -   -GAGAA   AA  AUAAUCCACAGUGACGACGGUGAGAAGAGGAACUGGAAGCAUGCGCCGUCGCUGAAG   UGUGUG GUGUG GAGUG AGU      GAG  GA                                                         G   |||||| ||||| ||||| |||      |||  ||                                                         A   ACACAU UACGU CUCAC UCA      UUC  GU                                                         A UA      -     -     C   AUAUAG   -A  GUUCAGGGUUGAUCUUUACUUCUUCCCCUUUCUUUUGUUUAUAAGCGGUGUAGGUGU
Stem-loop sequence	UGUGUGUGUGUGUGAGUGAGUGAGAAGAGAAGAAUAAUCCACAGUGACGACGGUGAGAAGAGGAACUGGAAGCAUGCGCCGUCGCUGAAGGAAUGUGGAUGUGGCGAAUAUUUGUUUUCUUUCCCCUUCUUCAUUUCUAGUUGGGACUUGUGACUUGAUAUAACUCCACUCUGCAUUACACAAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003549974.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||| targets:235   CUCACUCACACACACACACA   254 Target Full Sequence	0.0	PREDICTED: Glycine max subtilisin-like protease SBT1.7 (LOC100776647), mRNA	subtilisin-like protease SBT1.7(LOC100776647)	coding protein	psRNATarget
AK244022.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||| targets:8   CUCACUCACACACACACACA   27 Target Full Sequence	0.0	Glycine max cDNA, clone: GMFL01-01-O05	NA	coding protein	psRNATarget
XM_006584527.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||| targets:166   CUCACUCACACACACACACA   185 Target Full Sequence	0.0	PREDICTED: Glycine max uncharacterized LOC100804780 (LOC100804780), transcript variant X1, mRNA	uncharacterized LOC100804780(LOC100804780)	coding protein	psRNATarget
BT097273.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||| targets:113   CUCACUCACACACACACACA   132 Target Full Sequence	0.0	Soybean clone JCVI-FLGm-21F18 unknown mRNA	NA	coding protein	psRNATarget
NM_001255646.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||| targets:111   CUCACUCACACACACACACA   130 Target Full Sequence	0.0	Glycine max uncharacterized LOC100804780 (LOC100804780), mRNA	uncharacterized LOC100804780(LOC100804780)	coding protein	psRNATarget
XM_006598164.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||| targets:59   CUCACUCACACACACACACA   78 Target Full Sequence	0.0	PREDICTED: Glycine max uncharacterized LOC100810457 (LOC100810457), mRNA	uncharacterized LOC100810457(LOC100810457)	coding protein	psRNATarget
NM_001251198.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   *||||||||||||||||||| targets:309   AUCACUCACACACACACACA   328 Target Full Sequence	0.0	Glycine max uncharacterized LOC100500184 (LOC100500184), mRNA	uncharacterized LOC100500184(LOC100500184)	coding protein	psRNATarget
XM_014769469.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||||||||||||||||= targets:51   CUCACUCACACACACACACG   70 Target Full Sequence	1.0	PREDICTED: Glycine max transcription factor TCP12-like (LOC100803395), transcript variant X2, mRNA	transcription factor TCP12-like(LOC100803395)	coding protein	psRNATarget
XM_003524852.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:844   CUCUCUCACACACACACACA   863 Target Full Sequence	1.0	PREDICTED: Glycine max histidine kinase 3 (LOC100801546), mRNA	histidine kinase 3(LOC100801546)	coding protein	psRNATarget
AK245186.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:764   CUCUCUCACACACACACACA   783 Target Full Sequence	1.0	Glycine max cDNA, clone: GMFL01-23-D13	NA	coding protein	psRNATarget
XM_003546372.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:81   CUCUCUCACACACACACACA   100 Target Full Sequence	1.0	PREDICTED: Glycine max villin-4 (LOC100808499), transcript variant X1, mRNA	villin-4(LOC100808499)	coding protein	psRNATarget
XM_014767981.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:81   CUCUCUCACACACACACACA   100 Target Full Sequence	1.0	PREDICTED: Glycine max villin-4 (LOC100808499), transcript variant X2, mRNA	villin-4(LOC100808499)	coding protein	psRNATarget
AK286386.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:91   CUCUCUCACACACACACACA   110 Target Full Sequence	1.0	Glycine max cDNA, clone: GMFL01-27-B12	NA	coding protein	psRNATarget
XM_003519471.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:227   CUCUCUCACACACACACACA   246 Target Full Sequence	1.0	PREDICTED: Glycine max auxin response factor 6-like (LOC100809105), mRNA	auxin response factor 6-like(LOC100809105)	coding protein	psRNATarget
XM_006576700.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:152   CUCUCUCACACACACACACA   171 Target Full Sequence	1.0	PREDICTED: Glycine max 4-alpha-glucanotransferase DPE2-like (LOC100809128), transcript variant X1, mRNA	4-alpha-glucanotransferase DPE2-like(LOC100809128)	coding protein	psRNATarget
XM_014773716.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:153   CUCUCUCACACACACACACA   172 Target Full Sequence	1.0	PREDICTED: Glycine max 4-alpha-glucanotransferase DPE2-like (LOC100809128), transcript variant X2, mRNA	4-alpha-glucanotransferase DPE2-like(LOC100809128)	coding protein	psRNATarget
XM_003544747.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||||*|||||||||||||| targets:209   CUCACACACACACACACACA   228 Target Full Sequence	1.0	PREDICTED: Glycine max probable pectin methyltransferase QUA2 (LOC100787635), transcript variant X1, mRNA	probable pectin methyltransferase QUA2(LOC100787635)	coding protein	psRNATarget
XM_003546458.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:189   CUCUCUCACACACACACACA   208 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100808150 (LOC100808150), mRNA	uncharacterized LOC100808150(LOC100808150)	coding protein	psRNATarget
XM_003526411.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:354   CUCUCUCACACACACACACA   373 Target Full Sequence	1.0	PREDICTED: Glycine max probable xyloglucan glycosyltransferase 5 (LOC100776577), mRNA	probable xyloglucan glycosyltransferase 5(LOC100776577)	coding protein	psRNATarget
XM_014769507.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:1318   CUCUCUCACACACACACACA   1337 Target Full Sequence	1.0	PREDICTED: Glycine max ATP-dependent RNA helicase dbp8-like (LOC100806423), mRNA	ATP-dependent RNA helicase dbp8-like(LOC100806423)	coding protein	psRNATarget
XM_003553045.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:53   CUCUCUCACACACACACACA   72 Target Full Sequence	1.0	PREDICTED: Glycine max heat shock 70 kDa protein 16-like (LOC100808218), mRNA	heat shock 70 kDa protein 16-like(LOC100808218)	coding protein	psRNATarget
XM_003555650.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:359   CUCUCUCACACACACACACA   378 Target Full Sequence	1.0	PREDICTED: Glycine max 65-kDa microtubule-associated protein 6 (LOC100799043), transcript variant X1, mRNA	65-kDa microtubule-associated protein 6(LOC100799043)	coding protein	psRNATarget
XM_006579608.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:169   CUCUCUCACACACACACACA   188 Target Full Sequence	1.0	PREDICTED: Glycine max probable methyltransferase PMT14 (LOC100810763), transcript variant X2, mRNA	probable methyltransferase PMT14(LOC100810763)	coding protein	psRNATarget
AK286639.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:218   CUCUCUCACACACACACACA   237 Target Full Sequence	1.0	Glycine max cDNA, clone: GMFL01-33-D19	NA	coding protein	psRNATarget
XM_003524391.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:215   CUCUCUCACACACACACACA   234 Target Full Sequence	1.0	PREDICTED: Glycine max probable methyltransferase PMT14 (LOC100810763), transcript variant X1, mRNA	probable methyltransferase PMT14(LOC100810763)	coding protein	psRNATarget
XM_003542123.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:62   CUCUCUCACACACACACACA   81 Target Full Sequence	1.0	PREDICTED: Glycine max calmodulin-binding protein 60 B (LOC100790087), mRNA	calmodulin-binding protein 60 B(LOC100790087)	coding protein	psRNATarget
XM_006592225.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:252   CUCUCUCACACACACACACA   271 Target Full Sequence	1.0	PREDICTED: Glycine max protein UPSTREAM OF FLC-like (LOC100783687), transcript variant X1, mRNA	protein UPSTREAM OF FLC-like(LOC100783687)	coding protein	psRNATarget
XM_006592226.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:252   CUCUCUCACACACACACACA   271 Target Full Sequence	1.0	PREDICTED: Glycine max protein UPSTREAM OF FLC-like (LOC100783687), transcript variant X2, mRNA	protein UPSTREAM OF FLC-like(LOC100783687)	coding protein	psRNATarget
XM_006601165.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:109   CUCUCUCACACACACACACA   128 Target Full Sequence	1.0	PREDICTED: Glycine max protein indeterminate-domain 7-like (LOC100807813), transcript variant X1, mRNA	protein indeterminate-domain 7-like(LOC100807813)	coding protein	psRNATarget
XM_003518309.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:215   CUCUCUCACACACACACACA   234 Target Full Sequence	1.0	PREDICTED: Glycine max probable acyl-activating enzyme 6 (LOC100789991), mRNA	probable acyl-activating enzyme 6(LOC100789991)	coding protein	psRNATarget
XM_006601166.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:110   CUCUCUCACACACACACACA   129 Target Full Sequence	1.0	PREDICTED: Glycine max protein indeterminate-domain 7-like (LOC100807813), transcript variant X2, mRNA	protein indeterminate-domain 7-like(LOC100807813)	coding protein	psRNATarget
XM_003554732.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:304   CUCUCUCACACACACACACA   323 Target Full Sequence	1.0	PREDICTED: Glycine max rho GTPase-activating protein 3-like (LOC100800436), mRNA	rho GTPase-activating protein 3-like(LOC100800436)	coding protein	psRNATarget
XM_003546071.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:443   CUCUCUCACACACACACACA   462 Target Full Sequence	1.0	PREDICTED: Glycine max F-box/kelch-repeat protein At3g23880-like (LOC100779800), transcript variant X1, mRNA	F-box/kelch-repeat protein At3g23880-like(LOC100779800)	coding protein	psRNATarget
XM_014771419.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:378   CUCUCUCACACACACACACA   397 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100786645 (LOC100786645), transcript variant X1, mRNA	uncharacterized LOC100786645(LOC100786645)	coding protein	psRNATarget
XM_003519339.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:154   CUCUCUCACACACACACACA   173 Target Full Sequence	1.0	PREDICTED: Glycine max auxin transporter-like protein 1 (LOC100778259), mRNA	auxin transporter-like protein 1(LOC100778259)	coding protein	psRNATarget
XM_003555588.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:1811   CUCUCUCACACACACACACA   1830 Target Full Sequence	1.0	PREDICTED: Glycine max probable protein phosphatase 2C 38 (LOC100807559), mRNA	probable protein phosphatase 2C 38(LOC100807559)	coding protein	psRNATarget
BT099164.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:1689   CUCCCUCACACACACACACA   1708 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-26H16 unknown mRNA	NA	coding protein	psRNATarget
XM_006576192.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:273   CUCUCUCACACACACACACA   292 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100815367 (LOC100815367), transcript variant X1, mRNA	uncharacterized LOC100815367(LOC100815367)	coding protein	psRNATarget
XM_006587158.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:332   CUCUCUCACACACACACACA   351 Target Full Sequence	1.0	PREDICTED: Glycine max lipid phosphate phosphatase 2-like (LOC100782531), transcript variant X4, mRNA	lipid phosphate phosphatase 2-like(LOC100782531)	coding protein	psRNATarget
XM_006587157.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:332   CUCUCUCACACACACACACA   351 Target Full Sequence	1.0	PREDICTED: Glycine max lipid phosphate phosphatase 2-like (LOC100782531), transcript variant X3, mRNA	lipid phosphate phosphatase 2-like(LOC100782531)	coding protein	psRNATarget
XM_006587156.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:331   CUCUCUCACACACACACACA   350 Target Full Sequence	1.0	PREDICTED: Glycine max lipid phosphate phosphatase 2-like (LOC100782531), transcript variant X2, mRNA	lipid phosphate phosphatase 2-like(LOC100782531)	coding protein	psRNATarget
XM_003533876.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:327   CUCUCUCACACACACACACA   346 Target Full Sequence	1.0	PREDICTED: Glycine max lipid phosphate phosphatase 2-like (LOC100782531), transcript variant X1, mRNA	lipid phosphate phosphatase 2-like(LOC100782531)	coding protein	psRNATarget
XM_014773380.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:198   CUCUCUCACACACACACACA   217 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100815367 (LOC100815367), transcript variant X2, mRNA	uncharacterized LOC100815367(LOC100815367)	coding protein	psRNATarget
XM_003553495.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:542   CUCUCUCACACACACACACA   561 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100786645 (LOC100786645), transcript variant X2, mRNA	uncharacterized LOC100786645(LOC100786645)	coding protein	psRNATarget
XM_006587159.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:330   CUCUCUCACACACACACACA   349 Target Full Sequence	1.0	PREDICTED: Glycine max lipid phosphate phosphatase 2-like (LOC100782531), transcript variant X5, mRNA	lipid phosphate phosphatase 2-like(LOC100782531)	coding protein	psRNATarget
XM_003554379.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:463   CUCUCUCACACACACACACA   482 Target Full Sequence	1.0	PREDICTED: Glycine max zinc finger A20 and AN1 domain-containing stress-associated protein 4-like (LOC100789686), mRNA	zinc finger A20 and AN1 domain-containing stress-associated protein 4-like(LOC100789686)	coding protein	psRNATarget
NM_001248306.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |*|||||||||||||||||| targets:12   CACACUCACACACACACACA   31 Target Full Sequence	1.0	Glycine max RIN4c protein (RIN4c), mRNA	RIN4c protein(RIN4c)	coding protein	psRNATarget
BT097687.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |*|||||||||||||||||| targets:14   CACACUCACACACACACACA   33 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-22M2 unknown mRNA	NA	coding protein	psRNATarget
XM_003551926.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||| targets:72   CUCUCUCACACACACACACA   91 Target Full Sequence	1.0	PREDICTED: Glycine max transcription factor PRE6-like (LOC100800940), mRNA	transcription factor PRE6-like(LOC100800940)	coding protein	psRNATarget
XM_003521389.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   **|||||||||||||||||| targets:70   AACACUCACACACACACACA   89 Target Full Sequence	1.0	PREDICTED: Glycine max MADS-box transcription factor 6 (LOC100810549), mRNA	MADS-box transcription factor 6(LOC100810549)	coding protein	psRNATarget
XM_006600872.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|||*||||||||||||||| targets:496   UUCAGUCACACACACACACA   515 Target Full Sequence	1.0	PREDICTED: Glycine max kinesin-like protein FRA1 (LOC100790341), transcript variant X2, mRNA	kinesin-like protein FRA1(LOC100790341)	coding protein	psRNATarget
XM_014769944.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|||*||||||||||||||| targets:496   UUCAGUCACACACACACACA   515 Target Full Sequence	1.0	PREDICTED: Glycine max kinesin-like protein FRA1 (LOC100790341), transcript variant X1, mRNA	kinesin-like protein FRA1(LOC100790341)	coding protein	psRNATarget
XM_006600873.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|||*||||||||||||||| targets:496   UUCAGUCACACACACACACA   515 Target Full Sequence	1.0	PREDICTED: Glycine max kinesin-like protein FRA1 (LOC100790341), transcript variant X5, mRNA	kinesin-like protein FRA1(LOC100790341)	coding protein	psRNATarget
XM_006586009.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||*|||||||||||||||| targets:12   UUCUCUCACACACACACACA   31 Target Full Sequence	1.0	PREDICTED: Glycine max probable receptor-like protein kinase At2g42960 (LOC100784634), mRNA	probable receptor-like protein kinase At2g42960(LOC100784634)	coding protein	psRNATarget
XM_003552401.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||||*|||||||||||||| targets:83   UUCACACACACACACACACA   102 Target Full Sequence	1.0	PREDICTED: Glycine max serine carboxypeptidase-like 20 (LOC100790895), mRNA	serine carboxypeptidase-like 20(LOC100790895)	coding protein	psRNATarget
XM_003536241.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   *||||*|||||||||||||| targets:7   GUCACACACACACACACACA   26 Target Full Sequence	1.0	PREDICTED: Glycine max protein BTR1-like (LOC100783639), transcript variant X1, mRNA	protein BTR1-like(LOC100783639)	coding protein	psRNATarget
XM_006589291.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   *||||*|||||||||||||| targets:8   GUCACACACACACACACACA   27 Target Full Sequence	1.0	PREDICTED: Glycine max protein BTR1-like (LOC100783639), transcript variant X2, mRNA	protein BTR1-like(LOC100783639)	coding protein	psRNATarget
XM_003532996.3	ncRNA:19   AGUGAGUGUGUGUGUGUGU   1   ||||*|||||||||||||| targets:1   UCACACACACACACACACA   19 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100786760 (LOC100786760), mRNA	uncharacterized LOC100786760(LOC100786760)	coding protein	psRNATarget
XM_003540421.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||=||||||||| targets:78   CUCACUCACAUACACACACA   97 Target Full Sequence	1.5	PREDICTED: Glycine max probable bifunctional methylthioribulose-1-phosphate dehydratase/enolase-phosphatase E1 (LOC100796209), mRNA	probable bifunctional methylthioribulose-1-phosphate dehydratase/enolase-phosphatase E1(LOC100796209)	coding protein	psRNATarget
XM_003522935.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   *|||||||||||||=||||| targets:203   GUCACUCACACACAUACACA   222 Target Full Sequence	1.5	PREDICTED: Glycine max probable galacturonosyltransferase 11 (LOC100784212), mRNA	probable galacturonosyltransferase 11(LOC100784212)	coding protein	psRNATarget
XM_006585327.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||||*||||||| targets:56   CUCACUCACACAAACACACA   75 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100791744 (LOC100791744), mRNA	uncharacterized LOC100791744(LOC100791744)	coding protein	psRNATarget
BT097951.1	ncRNA:20   GAGUGA-GUGUGUGUGUGUGU   1   ||||||-|||||||||||||| targets:320   CUCACUUCACACACACACACA   340 Target Full Sequence	2.0	Soybean clone JCVI-FLGm-26O20 unknown mRNA	NA	coding protein	psRNATarget
XM_003542123.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |*|||*|||||||||||||| targets:82   CACACACACACACACACACA   101 Target Full Sequence	2.0	PREDICTED: Glycine max calmodulin-binding protein 60 B (LOC100790087), mRNA	calmodulin-binding protein 60 B(LOC100790087)	coding protein	psRNATarget
XM_006594822.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|=|=||||||||||||||| targets:1848   UUUAUUCACACACACACACA   1867 Target Full Sequence	2.0	PREDICTED: Glycine max SPX and EXS domain-containing protein 1-like (LOC100805271), transcript variant X3, mRNA	SPX and EXS domain-containing protein 1-like(LOC100805271)	coding protein	psRNATarget
XM_003543331.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|=|=||||||||||||||| targets:1843   UUUAUUCACACACACACACA   1862 Target Full Sequence	2.0	PREDICTED: Glycine max SPX and EXS domain-containing protein 1-like (LOC100805271), transcript variant X2, mRNA	SPX and EXS domain-containing protein 1-like(LOC100805271)	coding protein	psRNATarget
XM_006594821.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|=|=||||||||||||||| targets:1833   UUUAUUCACACACACACACA   1852 Target Full Sequence	2.0	PREDICTED: Glycine max SPX and EXS domain-containing protein 1-like (LOC100805271), transcript variant X1, mRNA	SPX and EXS domain-containing protein 1-like(LOC100805271)	coding protein	psRNATarget
XM_006594823.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|=|=||||||||||||||| targets:1755   UUUAUUCACACACACACACA   1774 Target Full Sequence	2.0	PREDICTED: Glycine max SPX and EXS domain-containing protein 1-like (LOC100805271), transcript variant X4, mRNA	SPX and EXS domain-containing protein 1-like(LOC100805271)	coding protein	psRNATarget
XM_006594824.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =|=|=||||||||||||||| targets:1729   UUUAUUCACACACACACACA   1748 Target Full Sequence	2.0	PREDICTED: Glycine max SPX and EXS domain-containing protein 1-like (LOC100805271), transcript variant X5, mRNA	SPX and EXS domain-containing protein 1-like(LOC100805271)	coding protein	psRNATarget
XM_014772396.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||=*|||||||||||||| targets:66   CUCAUACACACACACACACA   85 Target Full Sequence	2.0	PREDICTED: Glycine max B3 domain-containing transcription factor LEC2-like (LOC106797573), mRNA	B3 domain-containing transcription factor LEC2-like(LOC106797573)	coding protein	psRNATarget
XM_003548580.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||=||*|||||||||||||| targets:113   CUUACACACACACACACACA   132 Target Full Sequence	2.0	PREDICTED: Glycine max uncharacterized LOC100805677 (LOC100805677), mRNA	uncharacterized LOC100805677(LOC100805677)	coding protein	psRNATarget
XM_003549593.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||=||*|||||||||||||| targets:469   CUUACACACACACACACACA   488 Target Full Sequence	2.0	PREDICTED: Glycine max uncharacterized LOC100794197 (LOC100794197), mRNA	uncharacterized LOC100794197(LOC100794197)	coding protein	psRNATarget
XM_003552760.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |*|||||||||||||||||* targets:163   CACACUCACACACACACACU   182 Target Full Sequence	2.0	PREDICTED: Glycine max putative uncharacterized protein At4g01020, chloroplastic (HELRP), transcript variant X1, mRNA	putative uncharacterized protein At4g01020, chloroplastic(HELRP)	coding protein	psRNATarget
XM_003554631.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:100   CUCUCUCACACACACACACU   119 Target Full Sequence	2.0	PREDICTED: Glycine max protein HASTY 1-like (LOC100789688), transcript variant X5, mRNA	protein HASTY 1-like(LOC100789688)	coding protein	psRNATarget
XM_014763071.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:244   CUCUCUCACACACACACACU   263 Target Full Sequence	2.0	PREDICTED: Glycine max protein QUIRKY-like (LOC100807845), transcript variant X4, mRNA	protein QUIRKY-like(LOC100807845)	coding protein	psRNATarget
XM_006588845.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:243   CUCUCUCACACACACACACU   262 Target Full Sequence	2.0	PREDICTED: Glycine max protein QUIRKY-like (LOC100807845), transcript variant X1, mRNA	protein QUIRKY-like(LOC100807845)	coding protein	psRNATarget
XM_006580023.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:230   CUCUCUCACACACACACACU   249 Target Full Sequence	2.0	PREDICTED: Glycine max protein SHOOT GRAVITROPISM 5-like (LOC100806138), transcript variant X1, mRNA	protein SHOOT GRAVITROPISM 5-like(LOC100806138)	coding protein	psRNATarget
XM_014775654.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:295   CUCUCUCACACACACACACU   314 Target Full Sequence	2.0	PREDICTED: Glycine max protein SHOOT GRAVITROPISM 5-like (LOC100806138), transcript variant X2, mRNA	protein SHOOT GRAVITROPISM 5-like(LOC100806138)	coding protein	psRNATarget
XM_006600558.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:283   CUCUCUCACACACACACACU   302 Target Full Sequence	2.0	PREDICTED: Glycine max LOB domain-containing protein 25-like (LOC100775922), transcript variant X1, mRNA	LOB domain-containing protein 25-like(LOC100775922)	coding protein	psRNATarget
XM_006600559.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:284   CUCUCUCACACACACACACU   303 Target Full Sequence	2.0	PREDICTED: Glycine max LOB domain-containing protein 25-like (LOC100775922), transcript variant X2, mRNA	LOB domain-containing protein 25-like(LOC100775922)	coding protein	psRNATarget
XM_006594148.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||||||||* targets:51   CUCUCUCACACACACACACU   70 Target Full Sequence	2.0	PREDICTED: Glycine max protein LITTLE ZIPPER 4-like (LOC100789735), transcript variant X2, mRNA	protein LITTLE ZIPPER 4-like(LOC100789735)	coding protein	psRNATarget
XM_003544057.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   **|||||||||||||||||* targets:612   AGCACUCACACACACACACU   631 Target Full Sequence	2.0	PREDICTED: Glycine max auxin transporter-like protein 1 (LOC100817572), mRNA	auxin transporter-like protein 1(LOC100817572)	coding protein	psRNATarget
XM_006587129.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   **|||||||||||||||||* targets:299   AACACUCACACACACACACC   318 Target Full Sequence	2.0	PREDICTED: Glycine max zinc finger protein 8-like (LOC100806594), mRNA	zinc finger protein 8-like(LOC100806594)	coding protein	psRNATarget
XM_003528535.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||=||*||||||||||||| targets:292   UUCGCUGACACACACACACA   311 Target Full Sequence	2.0	PREDICTED: Glycine max cyclic dof factor 2 (LOC100813315), transcript variant X1, mRNA	cyclic dof factor 2(LOC100813315)	coding protein	psRNATarget
XM_006583900.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||=||*||||||||||||| targets:294   UUCGCUGACACACACACACA   313 Target Full Sequence	2.0	PREDICTED: Glycine max cyclic dof factor 2 (LOC100813315), transcript variant X2, mRNA	cyclic dof factor 2(LOC100813315)	coding protein	psRNATarget
XM_006579668.2	ncRNA:20   GA--GUGAGUGUGUGUGUGUGU   1   ||--|||||||||||||||||| targets:443   CUACCACUCACACACACACACA   464 Target Full Sequence	2.5	PREDICTED: Glycine max transcription factor CYCLOIDEA-like (LOC100803669), transcript variant X1, mRNA	transcription factor CYCLOIDEA-like(LOC100803669)	coding protein	psRNATarget
XM_014766030.1	ncRNA:20   GA--GUGAGUGUGUGUGUGUGU   1   ||--|||||||||||||||||| targets:118   CUUACACUCACACACACACACA   139 Target Full Sequence	2.5	PREDICTED: Glycine max GABA transporter 1-like (LOC100793688), mRNA	GABA transporter 1-like(LOC100793688)	coding protein	psRNATarget
XM_003545044.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||||||||||** targets:33   CUCACUCACACACACACAAC   52 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100816329 (LOC100816329), mRNA	uncharacterized LOC100816329(LOC100816329)	coding protein	psRNATarget
XM_006600536.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*|||||||||=|||||| targets:221   CUCUCUCACACACGCACACA   240 Target Full Sequence	2.5	PREDICTED: Glycine max teosinte glume architecture 1-like (LOC100812110), mRNA	teosinte glume architecture 1-like(LOC100812110)	coding protein	psRNATarget
XM_003526454.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   |||*||||||=||||||||| targets:14   CUCUCUCACAUACACACACA   33 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100800125 (LOC100800125), transcript variant X1, mRNA	uncharacterized LOC100800125(LOC100800125)	coding protein	psRNATarget
XM_003516626.3	ncRNA:20   GAGUGA--GUGUGUGUGUGUGU   1   *|||||--|||||||||||||| targets:150   GUCACUGUCACACACACACACA   171 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100802491 (LOC100802491), mRNA	uncharacterized LOC100802491(LOC100802491)	coding protein	psRNATarget
XM_003543365.3	ncRNA:20   GAGU--GAGUGUGUGUGUGUGU   1   *|||--|||||||||||||||| targets:230   GUCAGUCUCACACACACACACA   251 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100777475 (LOC100777475), mRNA	uncharacterized LOC100777475(LOC100777475)	coding protein	psRNATarget
XM_014774460.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||*||||||||* targets:1324   CUCACUCACAGACACACACU   1343 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100817704 (LOC100817704), transcript variant X1, mRNA	uncharacterized LOC100817704(LOC100817704)	coding protein	psRNATarget
XM_006577974.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||*||||||||* targets:1219   CUCACUCACAGACACACACU   1238 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100817704 (LOC100817704), transcript variant X3, mRNA	uncharacterized LOC100817704(LOC100817704)	coding protein	psRNATarget
AK286092.1	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||*||||||||* targets:18   CUCACUCACAAACACACACU   37 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-21-M04	NA	coding protein	psRNATarget
NM_001248469.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   ||||||||||*||||||||* targets:17   CUCACUCACAAACACACACU   36 Target Full Sequence	2.5	Glycine max nucleoside diphosphate kinase (LOC547870), mRNA	nucleoside diphosphate kinase(LOC547870)	coding protein	psRNATarget
XM_006597762.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||||*|||||||=|||||| targets:48   UUCACACACACACGCACACA   67 Target Full Sequence	2.5	PREDICTED: Glycine max lycopene epsilon cyclase, chloroplastic-like (LOC100788180), transcript variant X2, mRNA	lycopene epsilon cyclase, chloroplastic-like(LOC100788180)	coding protein	psRNATarget
XM_006597761.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||||*|||||||=|||||| targets:45   UUCACACACACACGCACACA   64 Target Full Sequence	2.5	PREDICTED: Glycine max lycopene epsilon cyclase, chloroplastic-like (LOC100788180), transcript variant X1, mRNA	lycopene epsilon cyclase, chloroplastic-like(LOC100788180)	coding protein	psRNATarget
XM_006574526.2	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   =||||*||||||||||||=| targets:1557   UUCACACACACACACACAUA   1576 Target Full Sequence	2.5	PREDICTED: Glycine max protein ALTERED XYLOGLUCAN 4-like (LOC100788415), mRNA	protein ALTERED XYLOGLUCAN 4-like(LOC100788415)	coding protein	psRNATarget
XM_003554757.3	ncRNA:20   GAGU---GAGUGUGUGUGUGUGU   1   ||||---|||||||||||||||| targets:59   CUCAUUUCUCACACACACACACA   81 Target Full Sequence	3.0	PREDICTED: Glycine max ankyrin repeat-containing protein At5g02620-like (LOC100814326), transcript variant X1, mRNA	ankyrin repeat-containing protein At5g02620-like(LOC100814326)	coding protein	psRNATarget
XM_006604871.2	ncRNA:20   GAGU---GAGUGUGUGUGUGUGU   1   ||||---|||||||||||||||| targets:59   CUCAUUUCUCACACACACACACA   81 Target Full Sequence	3.0	PREDICTED: Glycine max ankyrin repeat-containing protein At5g02620-like (LOC100814326), transcript variant X2, mRNA	ankyrin repeat-containing protein At5g02620-like(LOC100814326)	coding protein	psRNATarget
XM_006595957.2	ncRNA:20   GAGUGA-GUGUGUGUGUGUGU   1   |||=||-|||||||||||||| targets:106   CUCGCUUCACACACACACACA   126 Target Full Sequence	3.0	PREDICTED: Glycine max protein indeterminate-domain 7-like (LOC100783557), mRNA	protein indeterminate-domain 7-like(LOC100783557)	coding protein	psRNATarget
XM_014764352.1	ncRNA:20   GAGUGAGUGUGUGUGUGU-GU   1   =|||||||||||||||||-|| targets:316   UUCACUCACACACACACAACA   336 Target Full Sequence	3.0	PREDICTED: Glycine max TPR-containing protein kinase (LOC732542), transcript variant X1, mRNA	TPR-containing protein kinase(LOC732542)	coding protein	psRNATarget
AY954629.1	ncRNA:20   GAGUGAGUGUGUGUGUGU-GU   1   =|||||||||||||||||-|| targets:15   UUCACUCACACACACACAACA   35 Target Full Sequence	3.0	Glycine max TPR-containing protein kinase mRNA, complete cds, alternatively spliced	NA	coding protein	psRNATarget
NM_001249779.1	ncRNA:20   GAGUGAGUGUGUGUGUGU-GU   1   =|||||||||||||||||-|| targets:15   UUCACUCACACACACACAACA   35 Target Full Sequence	3.0	Glycine max TPR-containing protein kinase (LOC732542), mRNA	TPR-containing protein kinase(LOC732542)	coding protein	psRNATarget
XM_014762434.1	ncRNA:20   GAGUG---AGUGUGUGUGUGUGU   1   =||||---||||||||||||||| targets:105   UUCACAUUUCACACACACACACA   127 Target Full Sequence	3.0	PREDICTED: Glycine max polygalacturonate 4-alpha-galacturonosyltransferase-like (LOC100798073), transcript variant X1, mRNA	polygalacturonate 4-alpha-galacturonosyltransferase-like(LOC100798073)	coding protein	psRNATarget
XM_003533584.3	ncRNA:20   GAGUG---AGUGUGUGUGUGUGU   1   =||||---||||||||||||||| targets:105   UUCACAUUUCACACACACACACA   127 Target Full Sequence	3.0	PREDICTED: Glycine max polygalacturonate 4-alpha-galacturonosyltransferase-like (LOC100798073), transcript variant X2, mRNA	polygalacturonate 4-alpha-galacturonosyltransferase-like(LOC100798073)	coding protein	psRNATarget
XM_003529775.3	ncRNA:20   GAGUGAGUGUGUGUGUGUGU   1   *|===||||||||||||||| targets:2328   AUUGUUCACACACACACACA   2347 Target Full Sequence	3.0	PREDICTED: Glycine max verprolin-like (LOC100799093), mRNA	verprolin-like(LOC100799093)	coding protein	psRNATarget
XM_014767674.1	ncRNA:20   GA-GUGAGUGUGUGUGUGUGU   1   ||-|||*|||||||||||||| targets:702   CUGCACACACACACACACACA   722 Target Full Sequence	3.0	PREDICTED: Glycine max cucumisin-like (LOC106796115), mRNA	cucumisin-like(LOC106796115)	coding protein	psRNATarget