Search result

BaseInfo

ncRNA ID	novel_gma_miR3283
Species	Glycine max
Class	miRNA
Genome position	Chr15:1383688-1383732 [-]
Reference genome	Glycine_max_v2.0
Source	SRR1451672
Length	20
Mature sequence(if miRNA)	1 - UUUGGAUUUCUCAUAUUCAU - 20
Stem-loop(if miRNA)	--  UGC        C  UG  G   GA   UGUGAGAA UU  AG U   ||   |||||||| ||  || G   CU   AUACUCUU AG  UU C UA  --U        U  GU  A
Stem-loop sequence	GAUGCUGUGAGAACUUUGAGGUGCAUUUGGAUUUCUCAUAUUCAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006577068.2	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   ||||||||||||||||*||| targets:4958   AUGAAUAUGAGAAAUCAAAA   4977 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100779172 (LOC100779172), transcript variant X2, mRNA	uncharacterized LOC100779172(LOC100779172)	coding protein	psRNATarget
XM_006577069.2	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   ||||||||||||||||*||| targets:4958   AUGAAUAUGAGAAAUCAAAA   4977 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100779172 (LOC100779172), transcript variant X3, mRNA	uncharacterized LOC100779172(LOC100779172)	coding protein	psRNATarget
XM_006577067.2	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   ||||||||||||||||*||| targets:4958   AUGAAUAUGAGAAAUCAAAA   4977 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100779172 (LOC100779172), transcript variant X1, mRNA	uncharacterized LOC100779172(LOC100779172)	coding protein	psRNATarget
XM_014769854.1	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   =|||||*||||||||||||* targets:1955   GUGAAUUUGAGAAAUCCAAU   1974 Target Full Sequence	2.0	PREDICTED: Glycine max CCR4-NOT transcription complex subunit 10-like (LOC100802507), transcript variant X5, mRNA	CCR4-NOT transcription complex subunit 10-like(LOC100802507)	coding protein	psRNATarget
XM_003542591.3	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   =|||||*||||||||||||* targets:2716   GUGAAUUUGAGAAAUCCAAU   2735 Target Full Sequence	2.0	PREDICTED: Glycine max CCR4-NOT transcription complex subunit 10-like (LOC100812215), transcript variant X3, mRNA	CCR4-NOT transcription complex subunit 10-like(LOC100812215)	coding protein	psRNATarget
XM_006594181.2	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   =|||||*||||||||||||* targets:2720   GUGAAUUUGAGAAAUCCAAU   2739 Target Full Sequence	2.0	PREDICTED: Glycine max CCR4-NOT transcription complex subunit 10-like (LOC100812215), transcript variant X1, mRNA	CCR4-NOT transcription complex subunit 10-like(LOC100812215)	coding protein	psRNATarget
XM_003549694.3	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   =|||||*||||||||||||* targets:2716   GUGAAUUUGAGAAAUCCAAU   2735 Target Full Sequence	2.0	PREDICTED: Glycine max CCR4-NOT transcription complex subunit 10-like (LOC100802507), transcript variant X4, mRNA	CCR4-NOT transcription complex subunit 10-like(LOC100802507)	coding protein	psRNATarget
XM_014769853.1	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   =|||||*||||||||||||* targets:2720   GUGAAUUUGAGAAAUCCAAU   2739 Target Full Sequence	2.0	PREDICTED: Glycine max CCR4-NOT transcription complex subunit 10-like (LOC100802507), transcript variant X1, mRNA	CCR4-NOT transcription complex subunit 10-like(LOC100802507)	coding protein	psRNATarget
XM_014766941.1	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   |||*|*|||||||||||||| targets:770   AUGCACAUGAGAAAUCCAAA   789 Target Full Sequence	2.0	PREDICTED: Glycine max structural maintenance of chromosomes protein 3-like (LOC100810448), transcript variant X2, mRNA	structural maintenance of chromosomes protein 3-like(LOC100810448)	coding protein	psRNATarget
XM_003519418.3	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   |||*|*|||||||||||||| targets:1048   AUGCACAUGAGAAAUCCAAA   1067 Target Full Sequence	2.0	PREDICTED: Glycine max structural maintenance of chromosomes protein 3-like (LOC100779503), mRNA	structural maintenance of chromosomes protein 3-like(LOC100779503)	coding protein	psRNATarget
XM_003545492.3	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   |||*|*|||||||||||||| targets:1210   AUGCACAUGAGAAAUCCAAA   1229 Target Full Sequence	2.0	PREDICTED: Glycine max structural maintenance of chromosomes protein 3-like (LOC100810448), transcript variant X1, mRNA	structural maintenance of chromosomes protein 3-like(LOC100810448)	coding protein	psRNATarget
XM_003517942.3	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   ||*|=|*||||||||||||| targets:994   AUCAGUUUGAGAAAUCCAAA   1013 Target Full Sequence	3.0	PREDICTED: Glycine max ribonuclease 3-like (LOC100778239), mRNA	ribonuclease 3-like(LOC100778239)	coding protein	psRNATarget
BT098069.1	ncRNA:20   UACUUAUACUCUUUAGGUUU   1   |||*|*|||||||||||||= targets:619   AUGCAAAUGAGAAAUCCAAG   638 Target Full Sequence	3.0	Soybean clone JCVI-FLGm-26D19 unknown mRNA	NA	coding protein	psRNATarget