Search result

BaseInfo

ncRNA ID	novel_gma_miR3129
Species	Glycine max
Class	miRNA
Genome position	Chr18:56135621-56135768 [+]
Reference genome	Glycine_max_v2.0
Source	SRR1451670
Length	20
Mature sequence(if miRNA)	129 - CUUUCUCUCUGUCUCUCUCU - 148
Stem-loop(if miRNA)	----------   -          -------------AAA  AAACCCUAACUAACUACUAACCGAGGCUCCGGACGCAACCGCG           AGA AGAAAGAGAA                AG                                           G           ||| ||||||||||                ||           UCU UCUUUCUCUU                CU                                           U UCUCUCUCUG   C          GGCAAACUCUUAAAAU  CUGCAAUAGCCUAAAGUUUAGGUGUUAAGCGGCCUUAAACCCU
Stem-loop sequence	AGAAGAAAGAGAAAAAAGAAACCCUAACUAACUACUAACCGAGGCUCCGGACGCAACCGCGGUUCCCAAAUUCCGGCGAAUUGUGGAUUUGAAAUCCGAUAACGUCUCUAAAAUUCUCAAACGGUUCUCUUUCUCUCUGUCUCUCUCU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_003552589.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||||| targets:31   AGAGAGAGACAGAGAGAAAG   50 Target Full Sequence	0.0	PREDICTED: Glycine max protein CROWDED NUCLEI 1 (LOC100803601), mRNA	protein CROWDED NUCLEI 1(LOC100803601)	coding protein	psRNATarget
XM_006575447.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   ||||||||||||||||=||| targets:58   AGAGAGAGACAGAGAGGAAG   77 Target Full Sequence	1.5	PREDICTED: Glycine max ARF guanine-nucleotide exchange factor GNOM-like (LOC100811766), transcript variant X1, mRNA	ARF guanine-nucleotide exchange factor GNOM-like(LOC100811766)	coding protein	psRNATarget
XM_006595834.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:37   AGAGAGAGACAGAGAGAGAG   56 Target Full Sequence	1.5	PREDICTED: Glycine max ARF guanine-nucleotide exchange factor GNOM-like (LOC100784083), transcript variant X1, mRNA	ARF guanine-nucleotide exchange factor GNOM-like(LOC100784083)	coding protein	psRNATarget
XM_003519642.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:620   AGAGAGAGACAGAGAGAGAG   639 Target Full Sequence	1.5	PREDICTED: Glycine max probable serine/threonine-protein kinase At4g35230 (LOC100808907), transcript variant X1, mRNA	probable serine/threonine-protein kinase At4g35230(LOC100808907)	coding protein	psRNATarget
XM_014771057.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:613   AGAGAGAGACAGAGAGAGAG   632 Target Full Sequence	1.5	PREDICTED: Glycine max probable serine/threonine-protein kinase At4g35230 (LOC100808907), transcript variant X2, mRNA	probable serine/threonine-protein kinase At4g35230(LOC100808907)	coding protein	psRNATarget
XM_006575698.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:623   AGAGAGAGACAGAGAGAGAG   642 Target Full Sequence	1.5	PREDICTED: Glycine max probable serine/threonine-protein kinase At4g35230 (LOC100808907), transcript variant X3, mRNA	probable serine/threonine-protein kinase At4g35230(LOC100808907)	coding protein	psRNATarget
XM_014771061.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:625   AGAGAGAGACAGAGAGAGAG   644 Target Full Sequence	1.5	PREDICTED: Glycine max probable serine/threonine-protein kinase At4g35230 (LOC100808907), transcript variant X4, mRNA	probable serine/threonine-protein kinase At4g35230(LOC100808907)	coding protein	psRNATarget
BT093468.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:12   AGAGAGAGACAGAGAGAGAG   31 Target Full Sequence	1.5	Soybean clone JCVI-FLGm-14K7 unknown mRNA	NA	coding protein	psRNATarget
NM_001255536.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|| targets:10   AGAGAGAGACAGAGAGAGAG   29 Target Full Sequence	1.5	Glycine max transcription factor bHLH96-like (LOC100811408), mRNA	transcription factor bHLH96-like(LOC100811408)	coding protein	psRNATarget
XM_006575222.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:93   AGAGAGAGAGAGAGAGAAAG   112 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100793152 (LOC100793152), mRNA	uncharacterized LOC100793152(LOC100793152)	coding protein	psRNATarget
XM_006593877.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||*|||||| targets:33   AGAGAGAGACAGAAAGAAAG   52 Target Full Sequence	1.5	PREDICTED: Glycine max myosin-17-like (LOC100777802), mRNA	myosin-17-like(LOC100777802)	coding protein	psRNATarget
XM_006592608.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:100   AGAGAGAGAGAGAGAGAAAG   119 Target Full Sequence	1.5	PREDICTED: Glycine max ATP-dependent DNA helicase Q-like 4A (LOC100817867), transcript variant X1, mRNA	ATP-dependent DNA helicase Q-like 4A(LOC100817867)	coding protein	psRNATarget
XM_003556094.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:391   AGAGAGAGAGAGAGAGAAAG   410 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100811999 (LOC100811999), mRNA	uncharacterized LOC100811999(LOC100811999)	coding protein	psRNATarget
XM_003525165.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:164   AGAGAGAGAGAGAGAGAAAG   183 Target Full Sequence	1.5	PREDICTED: Glycine max histidine kinase 4-like (LOC100789894), transcript variant X2, mRNA	histidine kinase 4-like(LOC100789894)	coding protein	psRNATarget
XM_014771862.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:77   AGAGAGAGAGAGAGAGAAAG   96 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g16830 (LOC102670214), transcript variant X4, mRNA	putative pentatricopeptide repeat-containing protein At1g16830(LOC102670214)	coding protein	psRNATarget
XM_014765483.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1309   AGAGAGAGAGAGAGAGAAAG   1328 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X7, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014771865.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:78   AGAGAGAGAGAGAGAGAAAG   97 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g16830 (LOC102670214), transcript variant X7, mRNA	putative pentatricopeptide repeat-containing protein At1g16830(LOC102670214)	coding protein	psRNATarget
XM_003550545.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:84   AGAGAGAGAGAGAGAGAAAG   103 Target Full Sequence	1.5	PREDICTED: Glycine max serine/threonine-protein phosphatase 4 regulatory subunit 3-like (LOC100786790), transcript variant X1, mRNA	serine/threonine-protein phosphatase 4 regulatory subunit 3-like(LOC100786790)	coding protein	psRNATarget
XM_014765482.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1309   AGAGAGAGAGAGAGAGAAAG   1328 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X6, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_006593983.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1309   AGAGAGAGAGAGAGAGAAAG   1328 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X8, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014765478.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1226   AGAGAGAGAGAGAGAGAAAG   1245 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X1, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014769793.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:85   AGAGAGAGAGAGAGAGAAAG   104 Target Full Sequence	1.5	PREDICTED: Glycine max serine/threonine-protein phosphatase 4 regulatory subunit 3-like (LOC100786790), transcript variant X2, mRNA	serine/threonine-protein phosphatase 4 regulatory subunit 3-like(LOC100786790)	coding protein	psRNATarget
XM_014765479.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1206   AGAGAGAGAGAGAGAGAAAG   1225 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X2, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_006593984.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1309   AGAGAGAGAGAGAGAGAAAG   1328 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X9, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014771860.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:77   AGAGAGAGAGAGAGAGAAAG   96 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g16830 (LOC102670214), transcript variant X2, mRNA	putative pentatricopeptide repeat-containing protein At1g16830(LOC102670214)	coding protein	psRNATarget
XM_006593981.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1211   AGAGAGAGAGAGAGAGAAAG   1230 Target Full Sequence	1.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100793593), transcript variant X3, mRNA	protein PHR1-LIKE 1-like(LOC100793593)	coding protein	psRNATarget
XM_014771863.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:78   AGAGAGAGAGAGAGAGAAAG   97 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g16830 (LOC102670214), transcript variant X5, mRNA	putative pentatricopeptide repeat-containing protein At1g16830(LOC102670214)	coding protein	psRNATarget
XM_014771859.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:77   AGAGAGAGAGAGAGAGAAAG   96 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g16830 (LOC102670214), transcript variant X1, mRNA	putative pentatricopeptide repeat-containing protein At1g16830(LOC102670214)	coding protein	psRNATarget
XM_014771864.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:78   AGAGAGAGAGAGAGAGAAAG   97 Target Full Sequence	1.5	PREDICTED: Glycine max putative pentatricopeptide repeat-containing protein At1g16830 (LOC102670214), transcript variant X6, mRNA	putative pentatricopeptide repeat-containing protein At1g16830(LOC102670214)	coding protein	psRNATarget
AK245265.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1734   AGAGAGAGAGAGAGAGAAAG   1753 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-25-I03	NA	coding protein	psRNATarget
XM_003543286.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:69   AGAGAGAGAGAGAGAGAAAG   88 Target Full Sequence	1.5	PREDICTED: Glycine max probable serine/threonine-protein kinase At1g54610 (LOC100781209), mRNA	probable serine/threonine-protein kinase At1g54610(LOC100781209)	coding protein	psRNATarget
XM_006580950.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:436   AGAGAGAGAGAGAGAGAAAG   455 Target Full Sequence	1.5	PREDICTED: Glycine max cryptochrome-1-like (LOC100797839), transcript variant X2, mRNA	cryptochrome-1-like(LOC100797839)	coding protein	psRNATarget
XM_003556758.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:36   AGAGAGAGAGAGAGAGAAAG   55 Target Full Sequence	1.5	PREDICTED: Glycine max TPR repeat-containing thioredoxin TTL1-like (LOC100805790), mRNA	TPR repeat-containing thioredoxin TTL1-like(LOC100805790)	coding protein	psRNATarget
XM_006580949.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:436   AGAGAGAGAGAGAGAGAAAG   455 Target Full Sequence	1.5	PREDICTED: Glycine max cryptochrome-1-like (LOC100797839), transcript variant X1, mRNA	cryptochrome-1-like(LOC100797839)	coding protein	psRNATarget
XM_014769902.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:26   AGAGAGAGAGAGAGAGAAAG   45 Target Full Sequence	1.5	PREDICTED: Glycine max oxysterol-binding protein-related protein 2A-like (LOC100793692), transcript variant X1, mRNA	oxysterol-binding protein-related protein 2A-like(LOC100793692)	coding protein	psRNATarget
XM_006600770.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:26   AGAGAGAGAGAGAGAGAAAG   45 Target Full Sequence	1.5	PREDICTED: Glycine max oxysterol-binding protein-related protein 2A-like (LOC100793692), transcript variant X2, mRNA	oxysterol-binding protein-related protein 2A-like(LOC100793692)	coding protein	psRNATarget
XM_006592577.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1453   AGAGAGAGAGAGAGAGAAAG   1472 Target Full Sequence	1.5	PREDICTED: Glycine max 1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplastic-like (LOC100791297), transcript variant X6, mRNA	1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplastic-like(LOC100791297)	coding protein	psRNATarget
XM_014776556.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:322   AGAGAGAGAGAGAGAGAAAG   341 Target Full Sequence	1.5	PREDICTED: Glycine max HIPL1 protein-like (LOC100778890), transcript variant X1, mRNA	HIPL1 protein-like(LOC100778890)	coding protein	psRNATarget
XM_014777057.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:105   AGAGAGAGAAAGAGAGAAAG   124 Target Full Sequence	1.5	PREDICTED: Glycine max homeobox protein BEL1 homolog (LOC100800542), transcript variant X1, mRNA	homeobox protein BEL1 homolog(LOC100800542)	coding protein	psRNATarget
XM_003517428.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:105   AGAGAGAGAAAGAGAGAAAG   124 Target Full Sequence	1.5	PREDICTED: Glycine max homeobox protein BEL1 homolog (LOC100800542), transcript variant X2, mRNA	homeobox protein BEL1 homolog(LOC100800542)	coding protein	psRNATarget
XM_003543422.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:438   AGAGAGAGAGAGAGAGAAAG   457 Target Full Sequence	1.5	PREDICTED: Glycine max auxin response factor 18-like (LOC100808472), mRNA	auxin response factor 18-like(LOC100808472)	coding protein	psRNATarget
XM_003527001.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:312   AGAGAGAGAGAGAGAGAAAG   331 Target Full Sequence	1.5	PREDICTED: Glycine max HIPL1 protein-like (LOC100778890), transcript variant X2, mRNA	HIPL1 protein-like(LOC100778890)	coding protein	psRNATarget
XM_003531420.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:47   AGAGAGAGAGAGAGAGAAAG   66 Target Full Sequence	1.5	PREDICTED: Glycine max CTP synthase (LOC100788720), transcript variant X1, mRNA	CTP synthase(LOC100788720)	coding protein	psRNATarget
AK244506.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:8   AGAGAGAGAGAGAGAGAAAG   27 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-05-I10	NA	coding protein	psRNATarget
XM_014776160.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:436   AGAGAGAGAGAGAGAGAAAG   455 Target Full Sequence	1.5	PREDICTED: Glycine max cryptochrome-1-like (LOC100797839), transcript variant X4, mRNA	cryptochrome-1-like(LOC100797839)	coding protein	psRNATarget
XM_003535248.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:465   AGAGAGAGAGAGAGAGAAAG   484 Target Full Sequence	1.5	PREDICTED: Glycine max probable polygalacturonase (LOC100778981), mRNA	probable polygalacturonase(LOC100778981)	coding protein	psRNATarget
AK287396.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:51   AGAGAGAGAGAGAGAGAAAG   70 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-52-F11	NA	coding protein	psRNATarget
XM_003531421.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:47   AGAGAGAGAGAGAGAGAAAG   66 Target Full Sequence	1.5	PREDICTED: Glycine max CTP synthase (LOC100788720), transcript variant X2, mRNA	CTP synthase(LOC100788720)	coding protein	psRNATarget
XM_003553925.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:462   AGAGAGAGAGAGAGAGAAAG   481 Target Full Sequence	1.5	PREDICTED: Glycine max B3 domain-containing transcription factor FUS3-like (LOC100813055), mRNA	B3 domain-containing transcription factor FUS3-like(LOC100813055)	coding protein	psRNATarget
XM_006604319.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:228   AGAGAGAGAGAGAGAGAAAG   247 Target Full Sequence	1.5	PREDICTED: Glycine max transcription factor HBP-1b(c38)-like (LOC100799713), transcript variant X1, mRNA	transcription factor HBP-1b(c38)-like(LOC100799713)	coding protein	psRNATarget
XM_003554148.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:228   AGAGAGAGAGAGAGAGAAAG   247 Target Full Sequence	1.5	PREDICTED: Glycine max transcription factor HBP-1b(c38)-like (LOC100799713), transcript variant X2, mRNA	transcription factor HBP-1b(c38)-like(LOC100799713)	coding protein	psRNATarget
XM_006574600.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:252   AGAGAGAGAGAGAGAGAAAG   271 Target Full Sequence	1.5	PREDICTED: Glycine max protein MID1-COMPLEMENTING ACTIVITY 1-like (LOC100820146), transcript variant X4, mRNA	protein MID1-COMPLEMENTING ACTIVITY 1-like(LOC100820146)	coding protein	psRNATarget
XM_006582034.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:201   AGAGAGAGAGAGAGAGAAAG   220 Target Full Sequence	1.5	PREDICTED: Glycine max sodium-coupled neutral amino acid transporter 4-like (LOC100778699), mRNA	sodium-coupled neutral amino acid transporter 4-like(LOC100778699)	coding protein	psRNATarget
XM_006574602.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:252   AGAGAGAGAGAGAGAGAAAG   271 Target Full Sequence	1.5	PREDICTED: Glycine max protein MID1-COMPLEMENTING ACTIVITY 1-like (LOC100820146), transcript variant X3, mRNA	protein MID1-COMPLEMENTING ACTIVITY 1-like(LOC100820146)	coding protein	psRNATarget
XM_006574603.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:252   AGAGAGAGAGAGAGAGAAAG   271 Target Full Sequence	1.5	PREDICTED: Glycine max protein MID1-COMPLEMENTING ACTIVITY 1-like (LOC100820146), transcript variant X5, mRNA	protein MID1-COMPLEMENTING ACTIVITY 1-like(LOC100820146)	coding protein	psRNATarget
XM_006603752.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:146   AGAGAGAGAGAGAGAGAAAG   165 Target Full Sequence	1.5	PREDICTED: Glycine max serine/threonine-protein kinase HT1 (LOC100806635), mRNA	serine/threonine-protein kinase HT1(LOC100806635)	coding protein	psRNATarget
XM_014773010.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1241   AGAGAGAGAGAGAGAGAAAG   1260 Target Full Sequence	1.5	PREDICTED: Glycine max 40S ribosomal protein S12-like (LOC100800815), transcript variant X1, mRNA	40S ribosomal protein S12-like(LOC100800815)	coding protein	psRNATarget
XM_014765434.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:36   AGAGAGAGAGAGAGAGAAAG   55 Target Full Sequence	1.5	PREDICTED: Glycine max growth-regulating factor 1-like (LOC100783524), transcript variant X1, mRNA	growth-regulating factor 1-like(LOC100783524)	coding protein	psRNATarget
XM_006605500.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:1208   AGAGAGAGAGAGAGAGAAAG   1227 Target Full Sequence	1.5	PREDICTED: Glycine max 40S ribosomal protein S12-like (LOC100800815), transcript variant X3, mRNA	40S ribosomal protein S12-like(LOC100800815)	coding protein	psRNATarget
XM_014765435.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:33   AGAGAGAGAGAGAGAGAAAG   52 Target Full Sequence	1.5	PREDICTED: Glycine max growth-regulating factor 1-like (LOC100783524), transcript variant X3, mRNA	growth-regulating factor 1-like(LOC100783524)	coding protein	psRNATarget
XM_006593881.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:30   AGAGAGAGAGAGAGAGAAAG   49 Target Full Sequence	1.5	PREDICTED: Glycine max growth-regulating factor 1-like (LOC100783524), transcript variant X2, mRNA	growth-regulating factor 1-like(LOC100783524)	coding protein	psRNATarget
XM_003518711.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:225   AGAGAGAGAGAGAGAGAAAG   244 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100499984 (LOC100499984), mRNA	uncharacterized LOC100499984(LOC100499984)	coding protein	psRNATarget
XM_003554167.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:122   AGAGAGAGAGAGAGAGAAAG   141 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100810559 (LOC100810559), mRNA	uncharacterized LOC100810559(LOC100810559)	coding protein	psRNATarget
BT097697.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:223   AGAGAGAGAGAGAGAGAAAG   242 Target Full Sequence	1.5	Soybean clone JCVI-FLGm-26G24 unknown mRNA	NA	coding protein	psRNATarget
NM_001254313.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:223   AGAGAGAGAGAGAGAGAAAG   242 Target Full Sequence	1.5	Glycine max double-stranded RNA-binding protein 2-like (LOC100812728), mRNA	double-stranded RNA-binding protein 2-like(LOC100812728)	coding protein	psRNATarget
XM_006598159.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:157   AGAGAGAGAGAGAGAGAAAG   176 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X1, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
XM_014768392.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:155   AGAGAGAGAGAGAGAGAAAG   174 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X2, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
XM_006598160.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:158   AGAGAGAGAGAGAGAGAAAG   177 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X3, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
AK245552.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:69   AGAGAGAGAGAGAGAGAAAG   88 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-33-O20	NA	coding protein	psRNATarget
XM_006598161.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:155   AGAGAGAGAGAGAGAGAAAG   174 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X4, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
XM_006598162.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:152   AGAGAGAGAGAGAGAGAAAG   171 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X5, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
XM_006598163.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:157   AGAGAGAGAGAGAGAGAAAG   176 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X6, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
XM_003546783.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:154   AGAGAGAGAGAGAGAGAAAG   173 Target Full Sequence	1.5	PREDICTED: Glycine max myb family transcription factor APL-like (LOC100807793), transcript variant X7, mRNA	myb family transcription factor APL-like(LOC100807793)	coding protein	psRNATarget
XM_003525662.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:51   AGAGAGAGAGAGAGAGAAAG   70 Target Full Sequence	1.5	PREDICTED: Glycine max SNF1-related protein kinase regulatory subunit gamma-1 (LOC100812388), transcript variant X1, mRNA	SNF1-related protein kinase regulatory subunit gamma-1(LOC100812388)	coding protein	psRNATarget
XM_014775470.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:52   AGAGAGAGAGAGAGAGAAAG   71 Target Full Sequence	1.5	PREDICTED: Glycine max SNF1-related protein kinase regulatory subunit gamma-1 (LOC100812388), transcript variant X3, mRNA	SNF1-related protein kinase regulatory subunit gamma-1(LOC100812388)	coding protein	psRNATarget
AK245183.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:11   AGAGAGAGAGAGAGAGAAAG   30 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-23-C12	NA	coding protein	psRNATarget
XM_003551965.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:216   AGAGAGAGAGAGAGAGAAAG   235 Target Full Sequence	1.5	PREDICTED: Glycine max spermidine synthase 2 (LOC100776863), transcript variant X1, mRNA	spermidine synthase 2(LOC100776863)	coding protein	psRNATarget
AK243922.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:15   AGAGAGAGAGAGAGAGAAAG   34 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-01-J23	NA	coding protein	psRNATarget
XM_003539582.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:33   AGAGAGAGAGAGAGAGAAAG   52 Target Full Sequence	1.5	PREDICTED: Glycine max probable sodium/metabolite cotransporter BASS1, chloroplastic (LOC100788639), mRNA	probable sodium/metabolite cotransporter BASS1, chloroplastic(LOC100788639)	coding protein	psRNATarget
XM_014763495.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:73   AGAGAGAGAGAGAGAGAAAG   92 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100785081 (LOC100785081), transcript variant X1, mRNA	uncharacterized LOC100785081(LOC100785081)	coding protein	psRNATarget
XM_014763496.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:73   AGAGAGAGAGAGAGAGAAAG   92 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100785081 (LOC100785081), transcript variant X2, mRNA	uncharacterized LOC100785081(LOC100785081)	coding protein	psRNATarget
BT097750.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:9   AGAGAGAGAGAGAGAGAAAG   28 Target Full Sequence	1.5	Soybean clone JCVI-FLGm-16G24 unknown mRNA	NA	coding protein	psRNATarget
NM_001255705.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:7   AGAGAGAGAGAGAGAGAAAG   26 Target Full Sequence	1.5	Glycine max uncharacterized LOC100785081 (LOC100785081), mRNA	uncharacterized LOC100785081(LOC100785081)	coding protein	psRNATarget
DQ234265.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:224   AGAGAGAGAGAGAGAGAAAG   243 Target Full Sequence	1.5	Glycine max salt-tolerance protein mRNA, complete cds	NA	coding protein	psRNATarget
NM_001250253.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:224   AGAGAGAGAGAGAGAGAAAG   243 Target Full Sequence	1.5	Glycine max salt-tolerance protein (LOC732574), mRNA	salt-tolerance protein(LOC732574)	coding protein	psRNATarget
XM_006586735.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:50   AGAGAGAGAGAGAGAGAAAG   69 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized protein At4g26485-like (LOC100810848), transcript variant X1, mRNA	uncharacterized protein At4g26485-like(LOC100810848)	coding protein	psRNATarget
XM_003555935.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:234   AGAGAGAGAGAGAGAGAAAG   253 Target Full Sequence	1.5	PREDICTED: Glycine max PXMP2/4 family protein 4-like (LOC100816797), mRNA	PXMP2/4 family protein 4-like(LOC100816797)	coding protein	psRNATarget
NM_001250343.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:7   AGAGAGAGAGAGAGAGAAAG   26 Target Full Sequence	1.5	Glycine max bZIP transcription factor bZIP36 (BZIP36), mRNA	bZIP transcription factor bZIP36(BZIP36)	coding protein	psRNATarget
XM_003521012.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:37   AGAGAGAGAGAGAGAGAAAG   56 Target Full Sequence	1.5	PREDICTED: Glycine max probable WRKY transcription factor 12 (LOC100788263), mRNA	probable WRKY transcription factor 12(LOC100788263)	coding protein	psRNATarget
XM_006586736.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:51   AGAGAGAGAGAGAGAGAAAG   70 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized protein At4g26485-like (LOC100810848), transcript variant X3, mRNA	uncharacterized protein At4g26485-like(LOC100810848)	coding protein	psRNATarget
XM_003534943.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:50   AGAGAGAGAGAGAGAGAAAG   69 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized protein At4g26485-like (LOC100810848), transcript variant X2, mRNA	uncharacterized protein At4g26485-like(LOC100810848)	coding protein	psRNATarget
XM_006587221.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:33   AGAGAGAGAGAGAGAGAAAG   52 Target Full Sequence	1.5	PREDICTED: Glycine max short-chain dehydrogenase TIC 32, chloroplastic-like (LOC100776100), transcript variant X1, mRNA	short-chain dehydrogenase TIC 32, chloroplastic-like(LOC100776100)	coding protein	psRNATarget
XM_006601801.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:22   AGAGAGAGAGAGAGAGAAAG   41 Target Full Sequence	1.5	PREDICTED: Glycine max bZIP transcription factor bZIP36 (BZIP36), transcript variant X1, mRNA	bZIP transcription factor bZIP36(BZIP36)	coding protein	psRNATarget
XM_003556345.3	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:23   AGAGAGAGAGAGAGAGAAAG   42 Target Full Sequence	1.5	PREDICTED: Glycine max guanine nucleotide-binding protein subunit gamma 2-like (LOC100812916), mRNA	guanine nucleotide-binding protein subunit gamma 2-like(LOC100812916)	coding protein	psRNATarget
XM_006587222.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:33   AGAGAGAGAGAGAGAGAAAG   52 Target Full Sequence	1.5	PREDICTED: Glycine max short-chain dehydrogenase TIC 32, chloroplastic-like (LOC100776100), transcript variant X2, mRNA	short-chain dehydrogenase TIC 32, chloroplastic-like(LOC100776100)	coding protein	psRNATarget
XM_006592641.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:139   AGAGAGAGAGAGAGAGAAAG   158 Target Full Sequence	1.5	PREDICTED: Glycine max cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG1-like (LOC100780273), mRNA	cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG1-like(LOC100780273)	coding protein	psRNATarget
NM_001250792.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:5   AGAGAGAGAGAGAGAGAAAG   24 Target Full Sequence	1.5	Glycine max uncharacterized LOC100305600 (LOC100305600), mRNA	uncharacterized LOC100305600(LOC100305600)	coding protein	psRNATarget
BT089283.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:5   AGAGAGAGAGAGAGAGAAAG   24 Target Full Sequence	1.5	Soybean clone JCVI-FLGm-1H5 unknown mRNA	NA	coding protein	psRNATarget
BT090425.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:36   AGAGAGAGAGAGAGAGAAAG   55 Target Full Sequence	1.5	Soybean clone JCVI-FLGm-18I1 unknown mRNA	NA	coding protein	psRNATarget
XM_006591216.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:44   AGAGAGAGAGAGAGAGAAAG   63 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC102659448 (LOC102659448), mRNA	uncharacterized LOC102659448(LOC102659448)	coding protein	psRNATarget
BT093206.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:59   AGAGAGAGAGAGAGAGAAAG   78 Target Full Sequence	1.5	Soybean clone JCVI-FLGm-17A13 unknown mRNA	NA	coding protein	psRNATarget
AK287110.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||| targets:45   AGAGAGAGAGAGAGAGAAAG   64 Target Full Sequence	1.5	Glycine max cDNA, clone: GMFL01-44-F03	NA	coding protein	psRNATarget
XM_006604643.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   =||||||||*|||||||||| targets:174   GGAGAGAGAGAGAGAGAAAG   193 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100806105 (LOC100806105), transcript variant X1, mRNA	uncharacterized LOC100806105(LOC100806105)	coding protein	psRNATarget
XM_006604644.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   =||||||||*|||||||||| targets:174   GGAGAGAGAGAGAGAGAAAG   193 Target Full Sequence	1.5	PREDICTED: Glycine max uncharacterized LOC100806105 (LOC100806105), transcript variant X2, mRNA	uncharacterized LOC100806105(LOC100806105)	coding protein	psRNATarget
XM_006586148.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:574   AGAGAGAGACAGAGAGAGAA   593 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC102660218 (LOC102660218), mRNA	uncharacterized LOC102660218(LOC102660218)	coding protein	psRNATarget
XM_006576154.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:1915   AGAGAGAGACAGAGAGAGAA   1934 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100779351 (LOC100779351), transcript variant X6, mRNA	uncharacterized LOC100779351(LOC100779351)	coding protein	psRNATarget
XM_014771150.1	ncRNA:20   UCUC--UCUCUGUCUCUCUUUC   1   ||||--|||||||||||||||| targets:140   AGAGCAAGAGACAGAGAGAAAG   161 Target Full Sequence	2.5	PREDICTED: Glycine max transcription factor PIF4 (LOC100784531), transcript variant X1, mRNA	transcription factor PIF4(LOC100784531)	coding protein	psRNATarget
XM_006576153.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:1859   AGAGAGAGACAGAGAGAGAA   1878 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100779351 (LOC100779351), transcript variant X3, mRNA	uncharacterized LOC100779351(LOC100779351)	coding protein	psRNATarget
XM_014773364.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:1801   AGAGAGAGACAGAGAGAGAA   1820 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100779351 (LOC100779351), transcript variant X2, mRNA	uncharacterized LOC100779351(LOC100779351)	coding protein	psRNATarget
XM_006582994.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:395   AGAGAGAGACAGAGAGAGAC   414 Target Full Sequence	2.5	PREDICTED: Glycine max photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like (LOC100797323), transcript variant X2, mRNA	photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like(LOC100797323)	coding protein	psRNATarget
XM_006582991.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:395   AGAGAGAGACAGAGAGAGAC   414 Target Full Sequence	2.5	PREDICTED: Glycine max photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like (LOC100797323), transcript variant X1, mRNA	photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like(LOC100797323)	coding protein	psRNATarget
XM_014777650.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:217   AGAGAGAGACAGAGAGAGAC   236 Target Full Sequence	2.5	PREDICTED: Glycine max photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like (LOC100797323), transcript variant X6, mRNA	photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like(LOC100797323)	coding protein	psRNATarget
XM_006582993.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||||||||||=|* targets:217   AGAGAGAGACAGAGAGAGAC   236 Target Full Sequence	2.5	PREDICTED: Glycine max photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like (LOC100797323), transcript variant X5, mRNA	photosystem II D1 precursor processing protein PSB27-H2, chloroplastic-like(LOC100797323)	coding protein	psRNATarget
XM_006573062.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   ||||||=||||||||*|||| targets:1314   AGAGAGGGACAGAGAAAAAG   1333 Target Full Sequence	2.5	PREDICTED: Glycine max cell division cycle and apoptosis regulator protein 1-like (LOC100784665), transcript variant X2, mRNA	cell division cycle and apoptosis regulator protein 1-like(LOC100784665)	coding protein	psRNATarget
XM_006573061.2	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   ||||||=||||||||*|||| targets:1300   AGAGAGGGACAGAGAAAAAG   1319 Target Full Sequence	2.5	PREDICTED: Glycine max cell division cycle and apoptosis regulator protein 1-like (LOC100784665), transcript variant X1, mRNA	cell division cycle and apoptosis regulator protein 1-like(LOC100784665)	coding protein	psRNATarget
XM_014769150.1	ncRNA:20   UCUCUCUCUGUCUCUCUUUC   1   |||||||||*|||||||||* targets:1038   AGAGAGAGAGAGAGAGAAAA   1057 Target Full Sequence	2.5	PREDICTED: Glycine max homeobox-leucine zipper protein HDG11-like (LOC100785023), transcript variant X2, mRNA	homeobox-leucine zipper protein HDG11-like(LOC100785023)	coding protein	psRNATarget
XM_006583602.2	ncRNA:20   UCUCUCUCUGUCUCUCU-UUC   1   |||||||||||||||||-||| targets:70   AGAGAGAGACAGAGAGAGAAG   90 Target Full Sequence	3.0	PREDICTED: Glycine max putative two-component response regulator ARR21 (LOC102662997), transcript variant X1, mRNA	putative two-component response regulator ARR21(LOC102662997)	coding protein	psRNATarget
XM_006583604.2	ncRNA:20   UCUCUCUCUGUCUCUCU-UUC   1   |||||||||||||||||-||| targets:70   AGAGAGAGACAGAGAGAGAAG   90 Target Full Sequence	3.0	PREDICTED: Glycine max putative two-component response regulator ARR21 (LOC102662997), transcript variant X2, mRNA	putative two-component response regulator ARR21(LOC102662997)	coding protein	psRNATarget