Search result

BaseInfo

ncRNA ID	novel_gma_miR2967
Species	Glycine max
Class	miRNA
Genome position	Chr16:6197317-6197536 [-]
Reference genome	Glycine_max_v2.0
Source	SRR1451665
Length	20
Mature sequence(if miRNA)	1 - UCUCUCUCUCACACACGCAC - 20
Stem-loop(if miRNA)	--UA    A    C   -         CCUU  C   --UU      CCAUGUC ---  GGAACAAAAGUUGGUGACCCUUCUCCUCUUCGAAGUUAGUGGGGAGGAACCACUC     GUGU GUGA AGA AGAGAGAAA    AG AGU    CAGCGU       G   GU                                                       A     |||| |||| ||| |||||||||    || |||    ||||||       |   ||     CACA CACU UCU UCUCUCUUU    UC UCA    GUCGCG       C   GU                                                       C CACG    -    C   C         -CUC  -   CUUU      -UUUCUU UAU  UUUAACUCUGCUCCGACUUGUUUUUAUUCUCACAAAUCAAAGGGAAGACUACCAG
Stem-loop sequence	UAGUGUAGUGACAGAAGAGAGAAACCUUAGCAGUUUCAGCGUCCAUGUCGGUGGAACAAAAGUUGGUGACCCUUCUCCUCUUCGAAGUUAGUGGGGAGGAACCACUCACGACCAUCAGAAGGGAAACUAAACACUCUUAUUUUUGUUCAGCCUCGUCUCAAUUUUGUAUCUUCUUUGCGCUGUUUCACUCUCUCUUUCUCUCUCUCUCUCACACACGCAC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_006598682.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||||||||||||||||||| targets:59   GUGCGUGUGUGAGAGAGAGA   78 Target Full Sequence	0.0	PREDICTED: Glycine max tether containing UBX domain for GLUT4-like (LOC100792947), transcript variant X1, mRNA	tether containing UBX domain for GLUT4-like(LOC100792947)	coding protein	psRNATarget
XM_006587787.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1033   GUGUGUGUGUGAGAGAGAGA   1052 Target Full Sequence	1.0	PREDICTED: Glycine max U-box domain-containing protein 33-like (LOC100810508), transcript variant X2, mRNA	U-box domain-containing protein 33-like(LOC100810508)	coding protein	psRNATarget
XM_003534513.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1033   GUGUGUGUGUGAGAGAGAGA   1052 Target Full Sequence	1.0	PREDICTED: Glycine max U-box domain-containing protein 33-like (LOC100810508), transcript variant X1, mRNA	U-box domain-containing protein 33-like(LOC100810508)	coding protein	psRNATarget
XM_003540214.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:267   GUGUGUGUGUGAGAGAGAGA   286 Target Full Sequence	1.0	PREDICTED: Glycine max serine/threonine-protein kinase Nek5-like (LOC100818943), transcript variant X1, mRNA	serine/threonine-protein kinase Nek5-like(LOC100818943)	coding protein	psRNATarget
XM_003525165.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:369   GUGUGUGUGUGAGAGAGAGA   388 Target Full Sequence	1.0	PREDICTED: Glycine max histidine kinase 4-like (LOC100789894), transcript variant X2, mRNA	histidine kinase 4-like(LOC100789894)	coding protein	psRNATarget
XM_003555162.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:724   GUGUGUGUGUGAGAGAGAGA   743 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100807897 (LOC100807897), mRNA	uncharacterized LOC100807897(LOC100807897)	coding protein	psRNATarget
XM_003535709.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:674   GUGUGUGUGUGAGAGAGAGA   693 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100801471 (LOC100801471), mRNA	uncharacterized LOC100801471(LOC100801471)	coding protein	psRNATarget
AK245265.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1715   GUGUGUGUGUGAGAGAGAGA   1734 Target Full Sequence	1.0	Glycine max cDNA, clone: GMFL01-25-I03	NA	coding protein	psRNATarget
XM_003539758.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:160   GUGUGUGUGUGAGAGAGAGA   179 Target Full Sequence	1.0	PREDICTED: Glycine max glucomannan 4-beta-mannosyltransferase 2-like (LOC100791645), mRNA	glucomannan 4-beta-mannosyltransferase 2-like(LOC100791645)	coding protein	psRNATarget
XM_006605389.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:223   GUGUGUGUGUGAGAGAGAGA   242 Target Full Sequence	1.0	PREDICTED: Glycine max protein indeterminate-domain 5, chloroplastic-like (LOC102663407), transcript variant X2, mRNA	protein indeterminate-domain 5, chloroplastic-like(LOC102663407)	coding protein	psRNATarget
XM_006605388.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:223   GUGUGUGUGUGAGAGAGAGA   242 Target Full Sequence	1.0	PREDICTED: Glycine max protein indeterminate-domain 5, chloroplastic-like (LOC102663407), transcript variant X1, mRNA	protein indeterminate-domain 5, chloroplastic-like(LOC102663407)	coding protein	psRNATarget
XM_003541612.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:93   GUGUGUGUGUGAGAGAGAGA   112 Target Full Sequence	1.0	PREDICTED: Glycine max zinc finger CCCH domain-containing protein 34-like (LOC100782445), mRNA	zinc finger CCCH domain-containing protein 34-like(LOC100782445)	coding protein	psRNATarget
XM_006583622.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:77   GUGUGUGUGUGAGAGAGAGA   96 Target Full Sequence	1.0	PREDICTED: Glycine max protein indeterminate-domain 5, chloroplastic-like (LOC100806198), transcript variant X2, mRNA	protein indeterminate-domain 5, chloroplastic-like(LOC100806198)	coding protein	psRNATarget
XM_006583621.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:75   GUGUGUGUGUGAGAGAGAGA   94 Target Full Sequence	1.0	PREDICTED: Glycine max protein indeterminate-domain 5, chloroplastic-like (LOC100806198), transcript variant X1, mRNA	protein indeterminate-domain 5, chloroplastic-like(LOC100806198)	coding protein	psRNATarget
XM_003550359.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:92   GUGUGUGUGUGAGAGAGAGA   111 Target Full Sequence	1.0	PREDICTED: Glycine max protein SHI RELATED SEQUENCE 1-like (LOC100807290), mRNA	protein SHI RELATED SEQUENCE 1-like(LOC100807290)	coding protein	psRNATarget
XM_006576154.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1902   GUGUGUGUGUGAGAGAGAGA   1921 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100779351 (LOC100779351), transcript variant X6, mRNA	uncharacterized LOC100779351(LOC100779351)	coding protein	psRNATarget
XM_006576153.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1846   GUGUGUGUGUGAGAGAGAGA   1865 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100779351 (LOC100779351), transcript variant X3, mRNA	uncharacterized LOC100779351(LOC100779351)	coding protein	psRNATarget
XM_014773364.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1788   GUGUGUGUGUGAGAGAGAGA   1807 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100779351 (LOC100779351), transcript variant X2, mRNA	uncharacterized LOC100779351(LOC100779351)	coding protein	psRNATarget
XM_006603752.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:425   GUGUGUGUGUGAGAGAGAGA   444 Target Full Sequence	1.0	PREDICTED: Glycine max serine/threonine-protein kinase HT1 (LOC100806635), mRNA	serine/threonine-protein kinase HT1(LOC100806635)	coding protein	psRNATarget
XM_003551965.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:201   GUGUGUGUGUGAGAGAGAGA   220 Target Full Sequence	1.0	PREDICTED: Glycine max spermidine synthase 2 (LOC100776863), transcript variant X1, mRNA	spermidine synthase 2(LOC100776863)	coding protein	psRNATarget
XM_003539741.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:1204   GUGUGUGUGUGAGAGAGAGA   1223 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100782615 (LOC100782615), mRNA	uncharacterized LOC100782615(LOC100782615)	coding protein	psRNATarget
XM_003519239.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:475   GUGUGUGUGUGAGAGAGAGA   494 Target Full Sequence	1.0	PREDICTED: Glycine max uncharacterized LOC100814100 (LOC100814100), transcript variant X2, mRNA	uncharacterized LOC100814100(LOC100814100)	coding protein	psRNATarget
XM_003532258.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:18   GUGUGUGUGUGAGAGAGAGA   37 Target Full Sequence	1.0	PREDICTED: Glycine max (+)-neomenthol dehydrogenase-like (LOC100793649), mRNA	(+)-neomenthol dehydrogenase-like(LOC100793649)	coding protein	psRNATarget
XM_003524726.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:37   GUGUGUGUGUGAGAGAGAGA   56 Target Full Sequence	1.0	PREDICTED: Glycine max E3 ubiquitin-protein ligase SINA-like 10 (LOC100778869), mRNA	E3 ubiquitin-protein ligase SINA-like 10(LOC100778869)	coding protein	psRNATarget
NM_001250613.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:630   GUGUGUGUGUGAGAGAGAGA   649 Target Full Sequence	1.0	Glycine max zinc finger homeodomain protein SZF-HD1 (LOC547765), mRNA	zinc finger homeodomain protein SZF-HD1(LOC547765)	coding protein	psRNATarget
AY695729.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:630   GUGUGUGUGUGAGAGAGAGA   649 Target Full Sequence	1.0	Glycine max zinc finger homeodomain protein SZF-HD1 mRNA, complete cds	NA	coding protein	psRNATarget
BT093206.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||| targets:44   GUGUGUGUGUGAGAGAGAGA   63 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-17A13 unknown mRNA	NA	coding protein	psRNATarget
XM_006604781.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:102   UUGUGUGUGUGAGAGAGAGA   121 Target Full Sequence	1.0	PREDICTED: Glycine max mediator of RNA polymerase II transcription subunit 14-like (LOC100783484), mRNA	mediator of RNA polymerase II transcription subunit 14-like(LOC100783484)	coding protein	psRNATarget
XM_014775682.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:58   AUGUGUGUGUGAGAGAGAGA   77 Target Full Sequence	1.0	PREDICTED: Glycine max myb-like protein X (LOC102669001), transcript variant X3, mRNA	myb-like protein X(LOC102669001)	coding protein	psRNATarget
XM_003530405.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:119   CUGUGUGUGUGAGAGAGAGA   138 Target Full Sequence	1.0	PREDICTED: Glycine max luminal-binding protein 5 (LOC547838), mRNA	luminal-binding protein 5(LOC547838)	coding protein	psRNATarget
XM_003533771.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:1693   AUGUGUGUGUGAGAGAGAGA   1712 Target Full Sequence	1.0	PREDICTED: Glycine max probable WRKY transcription factor 47 (LOC100816719), mRNA	probable WRKY transcription factor 47(LOC100816719)	coding protein	psRNATarget
XM_014772865.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:102   AUGUGUGUGUGAGAGAGAGA   121 Target Full Sequence	1.0	PREDICTED: Glycine max putative Myb family transcription factor At1g14600 (LOC100796733), mRNA	putative Myb family transcription factor At1g14600(LOC100796733)	coding protein	psRNATarget
XM_014774311.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:92   CUGUGUGUGUGAGAGAGAGA   111 Target Full Sequence	1.0	PREDICTED: Glycine max MADS-box transcription factor PHERES 2-like (LOC106798339), mRNA	MADS-box transcription factor PHERES 2-like(LOC106798339)	coding protein	psRNATarget
U08382.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||| targets:84   CUGUGUGUGUGAGAGAGAGA   103 Target Full Sequence	1.0	Glycine max Century 84 BiP isoform C mRNA, partial cds	NA	coding protein	psRNATarget
NM_001249001.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||||||||||||||| targets:51   GUGAGUGUGUGAGAGAGAGA   70 Target Full Sequence	1.0	Glycine max ubiquitin-conjugation enzyme (LOC547652), mRNA	ubiquitin-conjugation enzyme(LOC547652)	coding protein	psRNATarget
AF532622.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||||||||||||||| targets:1   GUGAGUGUGUGAGAGAGAGA   20 Target Full Sequence	1.0	Glycine max ubiquitin-conjugation enzyme gene, complete cds	NA	coding protein	psRNATarget
NM_001249001.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||||||||||||||| targets:1   GUGAGUGUGUGAGAGAGAGA   20 Target Full Sequence	1.0	Glycine max ubiquitin-conjugation enzyme (LOC547652), mRNA	ubiquitin-conjugation enzyme(LOC547652)	coding protein	psRNATarget
BT089899.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||||||||||||||| targets:9   GUGAGUGUGUGAGAGAGAGA   28 Target Full Sequence	1.0	Soybean clone JCVI-FLGm-3I11 unknown mRNA	NA	coding protein	psRNATarget
XM_003536087.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||*|||||||||||||||| targets:210   CUGAGUGUGUGAGAGAGAGA   229 Target Full Sequence	1.0	PREDICTED: Glycine max ankyrin repeat domain-containing protein 13C-B-like (LOC100789308), mRNA	ankyrin repeat domain-containing protein 13C-B-like(LOC100789308)	coding protein	psRNATarget
AK244878.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||* targets:146   GUGUGUGUGUGAGAGAGAGC   165 Target Full Sequence	2.0	Glycine max cDNA, clone: GMFL01-15-N24	NA	coding protein	psRNATarget
NM_001251807.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||* targets:113   GUGUGUGUGUGAGAGAGAGC   132 Target Full Sequence	2.0	Glycine max BiP isoform B (BIP), mRNA	BiP isoform B(BIP)	coding protein	psRNATarget
U08383.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||||||||* targets:69   GUGUGUGUGUGAGAGAGAGC   88 Target Full Sequence	2.0	Glycine max Century 84 BiP isoform B mRNA, complete cds	NA	coding protein	psRNATarget
XM_003548207.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||||||||||||||= targets:438   UUGUGUGUGUGAGAGAGAGG   457 Target Full Sequence	2.0	PREDICTED: Glycine max calcium-transporting ATPase, endoplasmic reticulum-type-like (LOC100792952), transcript variant X2, mRNA	calcium-transporting ATPase, endoplasmic reticulum-type-like(LOC100792952)	coding protein	psRNATarget
XM_003518187.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   ||*=|||||||||||||||| targets:1125   GUUUGUGUGUGAGAGAGAGA   1144 Target Full Sequence	2.0	PREDICTED: Glycine max protein EXORDIUM-like 2 (LOC100800380), mRNA	protein EXORDIUM-like 2(LOC100800380)	coding protein	psRNATarget
XM_003551833.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *|*=|||||||||||||||| targets:1759   CUUUGUGUGUGAGAGAGAGA   1778 Target Full Sequence	2.0	PREDICTED: Glycine max AUGMIN subunit 4-like (LOC100790889), transcript variant X1, mRNA	AUGMIN subunit 4-like(LOC100790889)	coding protein	psRNATarget
XM_003527413.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|*|||||||||||||||| targets:2005   GAGAGUGUGUGAGAGAGAGA   2024 Target Full Sequence	2.0	PREDICTED: Glycine max L-ascorbate oxidase homolog (LOC100776222), mRNA	L-ascorbate oxidase homolog(LOC100776222)	coding protein	psRNATarget
XM_006584706.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|*|||||||||||||||| targets:143   GAGAGUGUGUGAGAGAGAGA   162 Target Full Sequence	2.0	PREDICTED: Glycine max 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic (LOC100798044), transcript variant X1, mRNA	3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic(LOC100798044)	coding protein	psRNATarget
XM_006584707.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|*|||||||||||||||| targets:142   GAGAGUGUGUGAGAGAGAGA   161 Target Full Sequence	2.0	PREDICTED: Glycine max 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic (LOC100798044), transcript variant X3, mRNA	3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic(LOC100798044)	coding protein	psRNATarget
XM_006584708.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|*|||||||||||||||| targets:142   GAGAGUGUGUGAGAGAGAGA   161 Target Full Sequence	2.0	PREDICTED: Glycine max 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic (LOC100798044), transcript variant X2, mRNA	3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic(LOC100798044)	coding protein	psRNATarget
XM_006584709.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|*|||||||||||||||| targets:143   GAGAGUGUGUGAGAGAGAGA   162 Target Full Sequence	2.0	PREDICTED: Glycine max 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic (LOC100798044), transcript variant X5, mRNA	3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic(LOC100798044)	coding protein	psRNATarget
XM_003530387.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|*|||||||||||||||| targets:140   GAGAGUGUGUGAGAGAGAGA   159 Target Full Sequence	2.0	PREDICTED: Glycine max 3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic (LOC100798044), transcript variant X4, mRNA	3-oxoacyl-[acyl-carrier-protein] synthase I, chloroplastic(LOC100798044)	coding protein	psRNATarget
AK245706.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   **|*|||||||||||||||| targets:83   AAGGGUGUGUGAGAGAGAGA   102 Target Full Sequence	2.0	Glycine max cDNA, clone: GMFL01-38-N02	NA	coding protein	psRNATarget
XM_006581134.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||=|||||| targets:105   GUGUGUGUGUGAGGGAGAGA   124 Target Full Sequence	2.5	PREDICTED: Glycine max mitogen-activated protein kinase homolog NTF3 (LOC100811862), transcript variant X2, mRNA	mitogen-activated protein kinase homolog NTF3(LOC100811862)	coding protein	psRNATarget
XM_003527933.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||=|||||| targets:104   GUGUGUGUGUGAGGGAGAGA   123 Target Full Sequence	2.5	PREDICTED: Glycine max mitogen-activated protein kinase homolog NTF3 (LOC100811862), transcript variant X1, mRNA	mitogen-activated protein kinase homolog NTF3(LOC100811862)	coding protein	psRNATarget
AK286667.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||||=|||||| targets:8   GUGUGUGUGUGAGGGAGAGA   27 Target Full Sequence	2.5	Glycine max cDNA, clone: GMFL01-33-P06	NA	coding protein	psRNATarget
XM_003537047.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||||*|||||||| targets:321   GUGUGUGUGUGUGAGAGAGA   340 Target Full Sequence	2.5	PREDICTED: Glycine max protein PHR1-LIKE 1-like (LOC100808743), transcript variant X3, mRNA	protein PHR1-LIKE 1-like(LOC100808743)	coding protein	psRNATarget
XM_006595426.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||||||||||||=|| targets:222   GUGGGUGUGUGAGAGAGGGA   241 Target Full Sequence	2.5	PREDICTED: Glycine max MAPK (LOC100305373), transcript variant X1, mRNA	MAPK(LOC100305373)	coding protein	psRNATarget
NM_001248388.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||*|||||||||| targets:185   GUGUGUGUGAGAGAGAGAGA   204 Target Full Sequence	2.5	Glycine max uncharacterized LOC100306200 (LOC100306200), mRNA	uncharacterized LOC100306200(LOC100306200)	coding protein	psRNATarget
BT095143.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||*|||||||||| targets:905   GUGUGUGUGAGAGAGAGAGA   924 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-6H6 unknown mRNA	NA	coding protein	psRNATarget
BT090192.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||*|||||||||| targets:13   GUGUGUGUGAGAGAGAGAGA   32 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-3J16 unknown mRNA	NA	coding protein	psRNATarget
BT092846.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||=|||||*|||||||||| targets:187   GUGUGUGUGAGAGAGAGAGA   206 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-12M23 unknown mRNA	NA	coding protein	psRNATarget
XM_006598662.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||*|||||||||||| targets:182   CUGUGUGAGUGAGAGAGAGA   201 Target Full Sequence	2.5	PREDICTED: Glycine max MADS-box transcription factor 6-like (LOC100779279), transcript variant X1, mRNA	MADS-box transcription factor 6-like(LOC100779279)	coding protein	psRNATarget
XM_003543427.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=||||*||||||||||| targets:137   UUGUGUGUCUGAGAGAGAGA   156 Target Full Sequence	2.5	PREDICTED: Glycine max cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG1-like (LOC100811156), mRNA	cytokinin riboside 5'-monophosphate phosphoribohydrolase LOG1-like(LOC100811156)	coding protein	psRNATarget
BT093681.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||*|||||||||||| targets:18   CUGUGUGAGUGAGAGAGAGA   37 Target Full Sequence	2.5	Soybean clone JCVI-FLGm-14A18 unknown mRNA	NA	coding protein	psRNATarget
NM_001255011.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   *||=|||*|||||||||||| targets:13   CUGUGUGAGUGAGAGAGAGA   32 Target Full Sequence	2.5	Glycine max MADS-box transcription factor 6-like (LOC100779279), mRNA	MADS-box transcription factor 6-like(LOC100779279)	coding protein	psRNATarget
XM_003550141.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||||||*|||||||| targets:143   GUGAGUGUGUGUGAGAGAGA   162 Target Full Sequence	2.5	PREDICTED: Glycine max zinc finger CCCH domain-containing protein 58-like (LOC100778426), mRNA	zinc finger CCCH domain-containing protein 58-like(LOC100778426)	coding protein	psRNATarget
XM_003519066.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||||*|||||||||*|||| targets:176   GUGCGAGUGUGAGAGUGAGA   195 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100810326 (LOC100810326), transcript variant X2, mRNA	uncharacterized LOC100810326(LOC100810326)	coding protein	psRNATarget
XM_006574436.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||||*|||||||||*|||| targets:129   GUGCGAGUGUGAGAGUGAGA   148 Target Full Sequence	2.5	PREDICTED: Glycine max uncharacterized LOC100810326 (LOC100810326), transcript variant X1, mRNA	uncharacterized LOC100810326(LOC100810326)	coding protein	psRNATarget
XM_014765432.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |||*|||*|||||||||||| targets:1244   GUGAGUGAGUGAGAGAGAGA   1263 Target Full Sequence	2.5	PREDICTED: Glycine max RING-H2 finger protein ATL52-like (LOC102668213), mRNA	RING-H2 finger protein ATL52-like(LOC102668213)	coding protein	psRNATarget
XM_006575598.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|=|||||||||||||||= targets:228   GGGUGUGUGUGAGAGAGAGG   247 Target Full Sequence	3.0	PREDICTED: Glycine max mitogen-activated protein kinase 10-like (LOC100781115), transcript variant X2, mRNA	mitogen-activated protein kinase 10-like(LOC100781115)	coding protein	psRNATarget
XM_006575597.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|=|||||||||||||||= targets:228   GGGUGUGUGUGAGAGAGAGG   247 Target Full Sequence	3.0	PREDICTED: Glycine max mitogen-activated protein kinase 10-like (LOC100781115), transcript variant X1, mRNA	mitogen-activated protein kinase 10-like(LOC100781115)	coding protein	psRNATarget
XM_003519503.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|=|||||||||||||||= targets:228   GGGUGUGUGUGAGAGAGAGG   247 Target Full Sequence	3.0	PREDICTED: Glycine max mitogen-activated protein kinase 10-like (LOC100781115), transcript variant X4, mRNA	mitogen-activated protein kinase 10-like(LOC100781115)	coding protein	psRNATarget
XM_006575600.2	ncRNA:20   CACGCACACACUCUCUCUCU   1   |*|=|||||||||||||||= targets:228   GGGUGUGUGUGAGAGAGAGG   247 Target Full Sequence	3.0	PREDICTED: Glycine max mitogen-activated protein kinase 10-like (LOC100781115), transcript variant X5, mRNA	mitogen-activated protein kinase 10-like(LOC100781115)	coding protein	psRNATarget
XM_014774766.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   |***|||||||||||||||| targets:378   GAAAGUGUGUGAGAGAGAGA   397 Target Full Sequence	3.0	PREDICTED: Glycine max HIPL1 protein-like (LOC100776176), mRNA	HIPL1 protein-like(LOC100776176)	coding protein	psRNATarget
XM_003556105.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   ****|||||||||||||||| targets:78   AAAAGUGUGUGAGAGAGAGA   97 Target Full Sequence	3.0	PREDICTED: Glycine max tubby-like F-box protein 8 (LOC100817532), transcript variant X1, mRNA	tubby-like F-box protein 8(LOC100817532)	coding protein	psRNATarget
AK245243.1	ncRNA:20   CACGCACACACUCUCUCUCU   1   ****|||||||||||||||| targets:27   AAAAGUGUGUGAGAGAGAGA   46 Target Full Sequence	3.0	Glycine max cDNA, clone: GMFL01-24-M22	NA	coding protein	psRNATarget
XM_003526891.3	ncRNA:20   CACGCACACACUCUCUCUCU   1   *|**|||||||||||||||| targets:116   AUCAGUGUGUGAGAGAGAGA   135 Target Full Sequence	3.0	PREDICTED: Glycine max bidirectional sugar transporter SWEET12-like (LOC100810426), transcript variant X1, mRNA	bidirectional sugar transporter SWEET12-like(LOC100810426)	coding protein	psRNATarget