Search result

BaseInfo

ncRNA ID ath-miR393a-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr2:16652101-16652233 [+]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 105 - AUCAUGCUAUCUCUUUGGAUU - 125
Stem-loop(if miRNA) A     A              C    U     -U     A  U  AUUCUCCCCAUAUUUUCUUUAU
 GAGGA GGAUCCAAAGGGAU GCAU GAUCC  AAUUA GG GA                      A
 ||||| |||||||||||||| |||| |||||  ||||| || ||                      A
 UUCCU CUUAGGUUUCUCUA CGUA CUAGG  UUGGU UC GU                      U
C     A              U    -     UU     -  -  UUAAAAACACUAAAUAAACGGU
Stem-loop sequence AGAGGAAGGAUCCAAAGGGAUCGCAUUGAUCCUAAUUAAGGUGAAUUCUCCCCAUAUUUUCUUUAUAAUUGGCAAAUAAAUCACAAAAAUUUGCUUGGUUUUGGAUCAUGCUAUCUCUUUGGAUUCAUCCUUC

Reference

1 PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA";
Jones-Rhoades MW, Bartel DP;
Mol Cell. 14:787-799(2004).
2 PMID:15258262
"Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis";
Sunkar R, Zhu JK;
Plant Cell. 16:2001-2019(2004).
3 PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets";
Wang XJ, Reyes JL, Chua NH, Gaasterland T;
Genome Biol. 5:R65(2004).
4 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
5 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).