ncRNA ID | ath-miR8121 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:16587970-16588110 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 24 |
Mature sequence(if miRNA) | 108 - AAAGUAUAAUGGUUUAGUGGUUUG - 131 |
Stem-loop(if miRNA) |
AUAAAU   -U   G         U           ------GUUGUCCU       GUUC     --AAC  GU       CCU  AAA UAUAAUGGU UAGUGGUUUGA              ACUAAUU    AAGGU     GA  U       |||  ||| ||||||||| |||||||||||              |||||||    |||||     ||       GGA  UUU AUAUUACUA AUUAUCAAACU              UGAUUAA    UUCCA     CU  C -UAAAU   UU   G         C           AAAUGAAUGUAAAU       -AAA     GACAA  AG |
Stem-loop sequence | AUAAAUCCUUAAAGUAUAAUGGUUUAGUGGUUUGAGUUGUCCUACUAAUUGUUCAAGGUAACGAGUUCGAUCAACAGACCUUAAAAAUUAGUUAAAUGUAAGUAAAUCAAACUAUUACAUCAUUAUAGUUUUUAGGUAAAU |
1 | PMID:23709668
"Comprehensive investigation of microRNAs enhanced by analysis of sequence variants, expression patterns, ARGONAUTE loading, and target cleavage"; Jeong DH, Thatcher SR, Brown RS, Zhai J, Park S, Rymarquis LA, Meyers BC, Green PJ; Plant Physiol. 162:1225-1245(2013). |