Search result

BaseInfo

ncRNA ID ath-miR160a-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr2:16340279-16340363 [+]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 64 - GCGUAUGAGGAGCCAUGCAUA - 84
Stem-loop(if miRNA)       C       CU         A   U   CC     A
GUAUGC UGGCUCC  GUAUGCCAU UGC GAG  CAUCG G
|||||| |||||||  ||||||||| ||| |||  ||||| U
UAUACG ACCGAGG  UAUGCGGUA GUG CUC  GUAGC A
      U       AG         G   C   CA     U
Stem-loop sequence GUAUGCCUGGCUCCCUGUAUGCCAUAUGCUGAGCCCAUCGAGUAUCGAUGACCUCCGUGGAUGGCGUAUGAGGAGCCAUGCAUAU

Reference

1 PMID:12101121
"MicroRNAs in plants";
Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP;
Genes Dev. 16:1616-1626(2002).
2 PMID:12202040
"Prediction of plant microRNA targets";
Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP;
Cell. 110:513-520(2002).
3 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
4 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
5 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
6 PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis";
Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW;
J Exp Bot. 61:165-177(2010).
7 PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots";
Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA;
BMC Genomics. 14:701(2013).