ncRNA ID | ath-miR160a-5p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:16340279-16340363 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 4 - UGCCUGGCUCCCUGUAUGCCA - 24 |
Stem-loop(if miRNA) |
      C       CU         A   U   CC     A GUAUGC UGGCUCC  GUAUGCCAU UGC GAG  CAUCG G |||||| |||||||  ||||||||| ||| |||  ||||| U UAUACG ACCGAGG  UAUGCGGUA GUG CUC  GUAGC A       U       AG         G   C   CA     U |
Stem-loop sequence | GUAUGCCUGGCUCCCUGUAUGCCAUAUGCUGAGCCCAUCGAGUAUCGAUGACCUCCGUGGAUGGCGUAUGAGGAGCCAUGCAUAU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BT002749.1 |
|
1.0 | Arabidopsis thaliana clone C104833 auxin response factor ARF17 (At1g77850) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX814425.1 |
|
1.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB73ZC01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY056184.1 |
|
1.0 | Arabidopsis thaliana auxin response factor ARF17 (At1g77850) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_106434.2 |
|
1.0 | Arabidopsis thaliana auxin response factor 17 (ARF17), mRNA | auxin response factor 17(ARF17) | coding protein | psRNATarget | |||||||||
NM_001334800.1 |
|
1.0 | Arabidopsis thaliana auxin response factor 17 (ARF17), mRNA | auxin response factor 17(ARF17) | coding protein | psRNATarget | |||||||||
AB493569.1 |
|
1.0 | Arabidopsis thaliana At2g28350 mRNA for hypothetical protein, partial cds, clone: RAAt2g28350 | NA | coding protein | psRNATarget | |||||||||
AF325073.1 |
|
1.0 | Arabidopsis thaliana unknown protein (At2g28350) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AF336919.1 |
|
1.0 | Arabidopsis thaliana clone C00034 (b) auxin response factor 10 (At2g28350) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
AF099735.1 |
|
1.0 | Arabidopsis thaliana auxin response factor 10 (ARF10) mRNA, partial cds | NA | coding protein | psRNATarget | |||||||||
NM_001336164.1 |
|
1.0 | Arabidopsis thaliana auxin response factor 10 (ARF10), mRNA | auxin response factor 10(ARF10) | coding protein | psRNATarget | |||||||||
NM_128394.5 |
|
1.0 | Arabidopsis thaliana auxin response factor 10 (ARF10), mRNA | auxin response factor 10(ARF10) | coding protein | psRNATarget | |||||||||
AY091198.1 |
|
2.0 | Arabidopsis thaliana putative transcription factor (At4g30080) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
BX828241.1 |
|
2.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH66ZF04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AY059792.1 |
|
2.0 | Arabidopsis thaliana putative transcription factor (At4g30080) mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
NM_119154.5 |
|
2.0 | Arabidopsis thaliana auxin response factor 16 (ARF16), mRNA | auxin response factor 16(ARF16) | coding protein | psRNATarget |
1 | PMID:12101121
"MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002). |
2 | PMID:12202040
"Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |
7 | PMID:24119003
"Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots"; Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA; BMC Genomics. 14:701(2013). |