Search result

BaseInfo

ncRNA ID ath-miR390a-3p
Species Arabidopsis thaliana
Class miRNA
Genome position chr2:16061954-16062060 [+]
Reference genome TAIR10
Source miRBase
Length 21
Mature sequence(if miRNA) 70 - CGCUAUCCAUCCUGAGUUUCA - 90
Stem-loop(if miRNA)     --      AU U  A          G           --U   -   C  A
GUAG  AGAAGA  C GU AAGCUCAGGA GGAUAGCGCCA   GAU GAU AC U
||||  ||||||  | || |||||||||| |||||||||||   ||| ||| ||
CAUC  UCUUCU  G UA UUUGAGUCCU CCUAUCGCGGU   UUA CUA UG U
    AU      CG U  C          A           UUU   U   U  C
Stem-loop sequence GUAGAGAAGAAUCUGUAAAGCUCAGGAGGGAUAGCGCCAUGAUGAUCACAUUCGUUAUCUAUUUUUUGGCGCUAUCCAUCCUGAGUUUCAUUGGCUCUUCUUACUAC

Reference

1 PMID:15608278
"ASRP: the Arabidopsis Small RNA Project Database";
Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD;
Nucleic Acids Res. 33:D637-D640(2005).
2 PMID:15632092
"Computational prediction of miRNAs in Arabidopsis thaliana";
Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V;
Genome Res. 15:78-91(2005).
3 PMID:16040653
"Expression of Arabidopsis MIRNA genes";
Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC;
Plant Physiol. 138:2145-2154(2005).
4 PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant";
Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC;
Genome Res. 16:1276-1288(2006).
5 PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana";
Rajagopalan R, Vaucheret H, Trejo J, Bartel DP;
Genes Dev. 20:3407-3425(2006).
6 PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis";
Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW;
J Exp Bot. 61:165-177(2010).