ncRNA ID | ath-miR390a-3p |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:16061954-16062060 [+] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 70 - CGCUAUCCAUCCUGAGUUUCA - 90 |
Stem-loop(if miRNA) |
    --      AU U  A          G           --U   -   C  A GUAG  AGAAGA  C GU AAGCUCAGGA GGAUAGCGCCA   GAU GAU AC U ||||  ||||||  | || |||||||||| |||||||||||   ||| ||| || CAUC  UCUUCU  G UA UUUGAGUCCU CCUAUCGCGGU   UUA CUA UG U     AU      CG U  C          A           UUU   U   U  C |
Stem-loop sequence | GUAGAGAAGAAUCUGUAAAGCUCAGGAGGGAUAGCGCCAUGAUGAUCACAUUCGUUAUCUAUUUUUUGGCGCUAUCCAUCCUGAGUUUCAUUGGCUCUUCUUACUAC |
1 | PMID:15608278
"ASRP: the Arabidopsis Small RNA Project Database"; Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD; Nucleic Acids Res. 33:D637-D640(2005). |
2 | PMID:15632092
"Computational prediction of miRNAs in Arabidopsis thaliana"; Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V; Genome Res. 15:78-91(2005). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |