ncRNA ID | novel_gma_miR2015 |
Species | Glycine max |
Class | miRNA |
Genome position | Chr19:23618124-23618217 [+] |
Reference genome | Glycine_max_v2.0 |
Source | SRR1451652;SRR1451655;SRR1451606;SRR1451609;SRR1451611 |
Length | 24 |
Mature sequence(if miRNA) | 1 - AUUUUGAAUUUGAAUUUUGAACCU - 24 |
Stem-loop(if miRNA) |
---A                UG ACCU  AAUCGAUUGUCAGAUGUUUG     UUUUGAAUUUGAAUUU  A    GU                    U     ||||||||||||||||  |    ||     AAAACUUAAACUUAAA  U    UC                    A ACUG                GU ---C  AAAGCAACGAUCAUUAGUUA |
Stem-loop sequence | AUUUUGAAUUUGAAUUUUGAACCUGUAAUCGAUUGUCAGAUGUUUGUAAUUGAUUACUAGCAACGAAACUCUUGAAAUUCAAAUUCAAAAGUCA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_003516345.3 |
|
1.5 | PREDICTED: Glycine max protein trichome birefringence-like 35 (LOC100789791), mRNA | protein trichome birefringence-like 35(LOC100789791) | coding protein | psRNATarget | |||||||||
XM_003518412.3 |
|
1.5 | PREDICTED: Glycine max BTB/POZ and MATH domain-containing protein 4 (LOC100806769), mRNA | BTB/POZ and MATH domain-containing protein 4(LOC100806769) | coding protein | psRNATarget |