ncRNA ID | novel_gma_miR1914 |
Species | Glycine max |
Class | miRNA |
Genome position | Chr1:52600385-52600440 [+] |
Reference genome | Glycine_max_v2.0 |
Source | SRR1451650 |
Length | 22 |
Mature sequence(if miRNA) | 1 - CGGAUUGACAAUCUGUAUGGCC - 22 |
Stem-loop(if miRNA) |
--                 --    C  A   CGGAUUGACAAUCUGUA  UGGC AU C   |||||||||||||||||  |||| ||   GCCUAACUGUUAGGCAU  ACCG UA G AU                 AC    U  G |
Stem-loop sequence | CGGAUUGACAAUCUGUAUGGCCAUACGGAUUGCCACAUACGGAUUGUCAAUCCGUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_006594260.2 |
|
3.0 | PREDICTED: Glycine max mediator of RNA polymerase II transcription subunit 16-like (LOC100793949), transcript variant X1, mRNA | mediator of RNA polymerase II transcription subunit 16-like(LOC100793949) | coding protein | psRNATarget |