Search result

BaseInfo

ncRNA ID	novel_gma_miR1839
Species	Glycine max
Class	miRNA
Genome position	Chr12:11031007-11031100 [+]
Reference genome	Glycine_max_v2.0
Source	SRR1451650
Length	22
Mature sequence(if miRNA)	73 - UUAACAUCGAUUUUGGAAAAAC - 94
Stem-loop(if miRNA)	--          C               G   U        A    U   UUUUUCGAAA UGAUGUUAACUACUC AUA UAACAUCG UUAU U   |||||||||| ||||||||||||||| ||| |||||||| ||||   AAAAGGUUUU GCUACAAUUGAUGAG UAU AUUGUAGC AAUA A CA          A               G   C        C    A
Stem-loop sequence	UUUUUCGAAACUGAUGUUAACUACUCGAUAUUAACAUCGAUUAUUUAAAUAACCGAUGUUACUAUGGAGUAGUUAACAUCGAUUUUGGAAAAAC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_014769234.1	ncRNA:22   CAAAAAGGUUUUAGCUACAAUU   1   *|*|||||||||||*||||||| targets:774   AUGUUUCCAAAAUCAAUGUUAA   795 Target Full Sequence	1.5	PREDICTED: Glycine max AP2-like ethylene-responsive transcription factor AIL1 (LOC100809762), transcript variant X2, mRNA	AP2-like ethylene-responsive transcription factor AIL1(LOC100809762)	coding protein	psRNATarget
XM_006598766.2	ncRNA:22   CAAAAAGGUUUUAGCUACAAUU   1   *|*|||||||||||*||||||| targets:771   AUGUUUCCAAAAUCAAUGUUAA   792 Target Full Sequence	1.5	PREDICTED: Glycine max AP2-like ethylene-responsive transcription factor AIL1 (LOC100809762), transcript variant X1, mRNA	AP2-like ethylene-responsive transcription factor AIL1(LOC100809762)	coding protein	psRNATarget
XM_006583096.2	ncRNA:22   CAAAAAGGUUUUAGCUACAAUU   1   *|*|||||||||||*||||||| targets:871   AUGUUUCCAAAAUCAAUGUUAA   892 Target Full Sequence	1.5	PREDICTED: Glycine max AP2-like ethylene-responsive transcription factor AIL1 (LOC100805489), mRNA	AP2-like ethylene-responsive transcription factor AIL1(LOC100805489)	coding protein	psRNATarget
XM_014774748.1	ncRNA:22   CAAAAAGGUUUUAGCUACAAUU   1   *|||||**=||||||||||||| targets:138   AUUUUUGGGAAAUCGAUGUUAA   159 Target Full Sequence	3.0	PREDICTED: Glycine max LON peptidase N-terminal domain and RING finger protein 1-like (LOC100797798), transcript variant X8, mRNA	LON peptidase N-terminal domain and RING finger protein 1-like(LOC100797798)	coding protein	psRNATarget
XM_014774747.1	ncRNA:22   CAAAAAGGUUUUAGCUACAAUU   1   *|||||**=||||||||||||| targets:136   AUUUUUGGGAAAUCGAUGUUAA   157 Target Full Sequence	3.0	PREDICTED: Glycine max LON peptidase N-terminal domain and RING finger protein 1-like (LOC100797798), transcript variant X7, mRNA	LON peptidase N-terminal domain and RING finger protein 1-like(LOC100797798)	coding protein	psRNATarget