Search result

BaseInfo

ncRNA ID	ath-miR399d
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr2:14442978-14443077 [-]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	11 - UGCCAAAGGAGAUUUGCCCCG - 31
Stem-loop(if miRNA)	U      A U        A     A       -UC     -----G  UA GG UGGAUU C GGGCGAAU CUCCU UGGCAGA   GCAUU      GC  G || |||||| | |||||||| ||||| |||||||   |||||      ||  A CC ACUUAA G CCCGUUUA GAGGA ACCGUCU   CGUAA      CG  U   U      C C        -     A       CUU     AAUGAA  UA
Stem-loop sequence	GGUUGGAUUACUGGGCGAAUACUCCUAUGGCAGAUCGCAUUGGCUAGAUAUGCAAGUAAAAUGCUUCUCUGCCAAAGGAGAUUUGCCCCGCAAUUCAUCC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AY074292.1	ncRNA:21   GCCCCGUUUAGAGGAAACCGU   1   =*|*||||||||||||||||| targets:886   UCGAGCAAAUCUCCUUUGGCA   906 Target Full Sequence	1.0	Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds	NA	coding protein	psRNATarget
AY074292.1	ncRNA:21   GCCCCGUUUAGAGGAAACCGU   1   =*|||||*||||||||||||| targets:740   UAGGGCAUAUCUCCUUUGGCA   760 Target Full Sequence	1.0	Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds	NA	coding protein	psRNATarget
NM_179887.3	ncRNA:21   GCCCCGUUUAGAGGAAACCGU   1   =*|*||||||||||||||||| targets:959   UCGAGCAAAUCUCCUUUGGCA   979 Target Full Sequence	1.0	Arabidopsis thaliana phosphate 2 (PHO2), mRNA	phosphate 2(PHO2)	coding protein	psRNATarget
NM_179887.3	ncRNA:21   GCCCCGUUUAGAGGAAACCGU   1   =*|||||*||||||||||||| targets:813   UAGGGCAUAUCUCCUUUGGCA   833 Target Full Sequence	1.0	Arabidopsis thaliana phosphate 2 (PHO2), mRNA	phosphate 2(PHO2)	coding protein	psRNATarget
AY074292.1	ncRNA:21   GCCCCGUUUAGAGGAAACCGU   1   =*||||||||||=|||||||| targets:607   UAGGGCAAAUCUUCUUUGGCA   627 Target Full Sequence	1.5	Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds	NA	coding protein	psRNATarget
NM_179887.3	ncRNA:21   GCCCCGUUUAGAGGAAACCGU   1   =*||||||||||=|||||||| targets:680   UAGGGCAAAUCUUCUUUGGCA   700 Target Full Sequence	1.5	Arabidopsis thaliana phosphate 2 (PHO2), mRNA	phosphate 2(PHO2)	coding protein	psRNATarget
AY074292.1	ncRNA:21   GC--CCCGUUUAGAGGAAACCGU   1   ||--||||||||||||||||||| targets:827   CGUUGGGCAAAUCUCCUUUGGCA   849 Target Full Sequence	2.5	Arabidopsis thaliana putative E2, ubiquitin-conjugating enzyme (At2g33770) mRNA, complete cds	NA	coding protein	psRNATarget
NM_179887.3	ncRNA:21   GC--CCCGUUUAGAGGAAACCGU   1   ||--||||||||||||||||||| targets:900   CGUUGGGCAAAUCUCCUUUGGCA   922 Target Full Sequence	2.5	Arabidopsis thaliana phosphate 2 (PHO2), mRNA	phosphate 2(PHO2)	coding protein	psRNATarget

Reference

1	PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"; Jones-Rhoades MW, Bartel DP; Mol Cell. 14:787-799(2004).
2	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
3	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
4	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
5	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).