ncRNA ID | ath-miR417 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | chr2:13708748-13708864 [-] |
Reference genome | TAIR10 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 20 - GAAGGUAGUGAAUUUGUUCGA - 40 |
Stem-loop(if miRNA) |
        U   -AA  -GG  AA    -CG      UUU           UC  CUU   GA AAAUAUAU CAA   GU   UC  AACA   UCACUA   CCUUUAUGUUU  CC   AUU  U |||||||| |||   ||   ||  ||||   ||||||   |||||||||||  ||   ||| UUUAUAUA GUU   UA   AG  UUGU   AGUGAU   GGAAGUACAAA  GG   UAA  G         -   GUA  AUA  -C    UUA      ---           UU  ---   AG |
Stem-loop sequence | AAAUAUAUUCAAAAGUGGUCAAAACACGUCACUAUUUCCUUUAUGUUUUCCCCUUAUUGAUGGAAAUGGUUAAACAUGAAGGUAGUGAAUUUGUUCGAAUAAUAUGUUGAUAUAUUU |
1 | PMID:15345049
"Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets"; Wang XJ, Reyes JL, Chua NH, Gaasterland T; Genome Biol. 5:R65(2004). |
2 | PMID:16669754
"MicroRNAS and their regulatory roles in plants"; Jones-Rhoades MW, Bartel DP, Bartel B; Annu Rev Plant Biol. 57:19-53(2006). |